Skip to main content

Table 1 Trachymyrmex septentrionalis polymorphic microsatellite markers analyzed for Trachymyrmex septentrionalis ants

From: Development, characterization, and cross-amplification of polymorphic microsatellite markers for North American Trachymyrmex and Mycetomoellerius ants

MarkerPrimer sequence 5′- > 3′Repeat motifTm (°C)Size (bp)NKHoHePI
Ts3a,b,cF: GCGCGGTTGTTCTTTATGG
R: TTGTATTCTTTGTCATACAGTACGTTGC
ATTTT60.5264–29225120.680.880.03
Ts4b,cF: CTTTGAAATCGTCATCGCGG
R: ACGCCCACACGTATACCACC
TCGGC57.3242–26625110.560.870.03
Ts5a,cF: CCACCTTGGTAACTGTCGCC
R: CTTTGAAATCGTCATCGCGG
TCGGC60.5230–25648110.670.810.06
Ts11b,cF: GCAGATACAAACGTCCTACGTGC
R: CGCACATTTGTGACGGACG
TGCG66.4274–35820130.450.910.02
Ts12b,cF: ATTCCTGGCACGGATACACG
R: ACTCTATTGTTGCGCACCGC
ATAC61.3164–2142690.350.650.16
Ts21cF: CCATCCCAACCATCCTGG
R: TTACGATCAGGAGAGCGTGC
AGCC65.2302–32645110.760.820.05
Ts25cF: CGTAAATTAAAGTGCACAGTCCG
R: GATCGCGATTTGGTGATACG
TCTG61.3286–34651180.780.860.03
Ts32b,cF: ATAACAAGCGGCAGCATCG
R: ATTTCGAACTCGCCGGTAGC
TTGG59.4200–24249150.760.850.04
Ts33F: AATCAAATGCTTGCGTGTGC
R: CCGGTTAGAAGAAACAGGCG
TGCG60.5248–29651150.710.730.09
Ts34b,cF: GTGAGGGAATGAGAGGGAGG
R: TGGTAATGATCGGTACATGATGC
TGCG61.3246–49027120.110.810.06
Ts35b,cF: TGCTCGATTCGGACACGG
R: CTCACAGCGGAGACAAAGGC
ACCG60.5188–30049140.890.760.08
Ts36b,cF: TGTAGGGATTTAGATGCGGC
R: TAGCCAGACCTCGTACTTCG
TGCG59.4166–2101390.150.850.04
Ts39cF: CTAACAAGATGCGCAGCCC
R: TCGAATAATCCAGTCGTGTCG
TGCC61.3234–35050300.840.940.01
Ts41F: TTAACGTCGGCATAATTTCGG
R: CAATTGACTACGCAGGAGCG
TGCC61.3206–23646140.780.820.05
Ts43cF: CGTCTTTATATTGTATTTGCTTGATACGC
R: GTCCATGCACACGTCCAGC
TGCG61.3246–35847330.720.940.01
Ts45b,cF: CGTGTCAAGTATGTTCCCGC
R: AGTTTCAGGCGCAGGTAGC
TGCG61.3174–31648280.600.890.02
Ts46cF: GTACGCACATCGTGCTAAACG
R: AGCGGTGGTGGTTTCACG
TGCG60.5310–34846200.780.920.01
  1. Details include: marker information, primer sequences, repeat motif, annealing temperature (Tm), size range of observed alleles given in base pairs (bp), number of individuals genotyped (N), number of alleles observed (K), observed heterozygosity (Ho), expected heterozygosity (He), and probability of identity (PI)
  2. aIndicates that 30 cycles were used in the PCR profile
  3. bIndicates deviation from Hardy–Weinberg expectations after Bonferroni corrections
  4. cIndicates the marker shows evidence of null alleles
\