Skip to main content

Table 2 Mycetomoellerius turrifex polymorphic microsatellite markers analyzed for Mycetomoellerius turrifex ants

From: Development, characterization, and cross-amplification of polymorphic microsatellite markers for North American Trachymyrmex and Mycetomoellerius ants

MarkerPrimer sequence 5′- > 3′Repeat motifTm (°C)Size (bp)NKHoHePI
Tt5F: ACGGAATGTGTTAACGTGCG
R: TATGTGCTCGTCGTTCTCGC
TGCG60.5254–32214100.710.860.04
Tt10b,cF: ACCGGAGAGCGGTAGAGACC
R: TACCCGGCCATTAGAACTCC
AGGT58.3286–32016110.50.850.04
Tt18F: GGTGATGGTCGATAGTTTCCG
R: ACGACGTATGGGTTCGTGC
AACG60.5196–2441670.440.580.20
Tt20F: ATGCAGAGTCAGAGGACCGC
R: GAATTGTCTCCACATTATCAAGGG
TGCG60.5218–2361570.670.780.08
Tt2b,cF: AATGTCGGACGTTTATGGTCG
R: GTATCATCGGCACTGCAACG
TTGCG56.2266–3141670.440.770.09
Tt7a,b,cF: GCAGTATGACTTCTGATCCTTTCG
R: CACGTTAATCCAGCACTCCG
TGCG66.2156–1761540.200.580.26
Tt9aF: ACGCACTGTGTATGTGTGCG
R: AGCATATAAGTACGAATAACTGAGATTGG
TGCG66.2188–26410120.700.830.04
Tt16F: TCGATTTATTAGAAAGGCTTGCG
R: TGCACGAGAGTGTTTGTAGCC
AGTG55.1272–2881350.540.740.11
Tt6b,cF: TTATATCGATGGCTTCCCACC
R: CCCTCTCGATATCTACTCGGTACG
AGGT57.3318–35815110.270.850.04
Tt14aF: AAGTCGCGTAATGACGATGC
R: GAGATATACCTGATTCAACGTCGC
ATAC57.3256–37815100.600.770.08
Tt15a,b,cF: TGCCTTCATATATGTGCCTTCG
R: TGTCGTTAAGAGTTACAGAACAGGG
TGCG65.3238–30412120.420.880.03
Tt17b,cF: TCACTCAAATCGAATATGTAGATGAGG
R: CCCACAGTAATGTCCTAGTAATGTCC
TGCG64.4148–19815110.470.880.03
  1. Details include: marker information, primer sequences, repeat motif, annealing temperature (Tm), size range of observed alleles given in base pairs (bp), number of individuals genotyped (N), number of alleles observed (K), observed heterozygosity (Ho), expected heterozygosity (He), and probability of identity (PI)
  2. aIndicates that 30 cycles were used in the PCR profile
  3. bIndicates deviation from Hardy–Weinberg expectations after Bonferroni corrections
  4. cIndicates the marker shows evidence of null alleles
\