Skip to main content

Table 2 Nucleotide sequences of primers used for real-time RT-PCR

From: Evaluating the expression level of miR-9-5p and miR-192-5p in gastrointestinal cancer: introducing novel screening biomarkers for patients

GeneForward primer (5′–3′)Reverse primer (5′–3′)
U6GAGAAGATTAGCATGGCCCCTATATGGAACGCTTCACGAATTTGC
miR-9CTTTGGTTATCTAGCTGTATGAGTCGTATCCAGTGCAGGGTCCGA
miR-192CTGACCTATGAATTGACAGCCGTATCCAGTGCAGGGTCCGA