Expression patterns of SLIT/ROBO mRNAs reveal a characteristic feature in the entorhinal-hippocampal area of macaque monkeys

Table 1 ISH probes used in this study

Gene name	Probe name	Species	Accession No.	PCR primer set	Length
SLIT1	Slit1-1	macaque	NM_003061	cttccaggacctgcagaacc	552
	Slit1-1	macaque	NM_003061	cccgtcttcgatctcggaca
	Slit1-2	macaque	NM_003061	aagtttgaatgccaaggtcc	448
	Slit1-2	macaque	NM_003061	actgggcctcgtgttgacat	448
	Slit1-3	macaque	NM_003061	cttgtgctctccggatctga	822
	Slit1-3	macaque	NM_003061	gtacaggtttcggatgcaac	822
	Slit1-4	macaque	NM_003061	cctgtggcagatcctcaacg	647
	Slit1-4	macaque	NM_003061	ccatcgctgcactcaaaggt	647
SLIT2	Slit2-1	macaque	NM_00478	cccaggaatatcccccgcaa	770
	Slit2-1	macaque	NM_00478	gagaccatcacagaaatacg	770
	Slit2-4	macaque	NM_004787	cagcccctgtgataattttg	866
	Slit2-4	macaque	NM_004787	gtcctctgtgatgaagagga	866
SLIT3	Slit3-3	macaque	NM_003062	ttgacctgagcaacaacagc	838
SLIT3	Slit3-3	macaque	NM_003062	ccctggacaaaggattcag	838
ROBO1	Robo1-1	macaque	NM-022188	ggagaggctgtgagccacaa	942
	Robo1-1	macaque	NM-022188	tcctgtgaatcagactgtag	942
	Robo1-3	macaque	NM-022188	tggttagtttttgaagtgag	877
	Robo1-3	macaque	NM-022188	acctacagtcgcccagctga	877
	Robo1-4	macaque	NM-022188	ctgatgctccctgagtcaac	868
	Robo1-4	macaque	NM-022188	ggctacatttcaggacccct	868
ROBO2	Robo2-1	macaque	NM_002942	aggaactatcttggtgaagc	700
	Robo2-1	macaque	NM_002942	ggaaacccacagccagctgt	700
	Robo2-4	macaque	NM_002942	ccaggccaaggggataaaac	673
	Robo2-4	macaque	NM_002942	gcctatcagtttgatatagc	673

We confirmed that the multiple probes for one gene exhibit the same distribution pattern. After the initial confirmation, these multiple probes were mixed to enhance the ISH signals

ISSN: 1756-0500