Skip to main content

Table 1 ISH probes used in this study

From: Expression patterns of SLIT/ROBO mRNAs reveal a characteristic feature in the entorhinal-hippocampal area of macaque monkeys

Gene name Probe name Species Accession No. PCR primer set Length
SLIT1 Slit1-1 macaque NM_003061 cttccaggacctgcagaacc 552
cccgtcttcgatctcggaca  
Slit1-2 macaque NM_003061 aagtttgaatgccaaggtcc 448
actgggcctcgtgttgacat
Slit1-3 macaque NM_003061 cttgtgctctccggatctga 822
gtacaggtttcggatgcaac
Slit1-4 macaque NM_003061 cctgtggcagatcctcaacg 647
ccatcgctgcactcaaaggt
SLIT2 Slit2-1 macaque NM_00478  cccaggaatatcccccgcaa 770
gagaccatcacagaaatacg
Slit2-4 macaque NM_004787 cagcccctgtgataattttg 866
gtcctctgtgatgaagagga
SLIT3 Slit3-3 macaque NM_003062 ttgacctgagcaacaacagc 838
ccctggacaaaggattcag
ROBO1 Robo1-1 macaque NM-022188 ggagaggctgtgagccacaa 942
tcctgtgaatcagactgtag
Robo1-3 macaque NM-022188 tggttagtttttgaagtgag 877
acctacagtcgcccagctga
Robo1-4 macaque NM-022188 ctgatgctccctgagtcaac 868
ggctacatttcaggacccct
ROBO2 Robo2-1 macaque NM_002942 aggaactatcttggtgaagc 700
ggaaacccacagccagctgt
Robo2-4 macaque NM_002942 ccaggccaaggggataaaac 673
gcctatcagtttgatatagc
  1. We confirmed that the multiple probes for one gene exhibit the same distribution pattern. After the initial confirmation, these multiple probes were mixed to enhance the ISH signals