Skip to main content

Table 2 Primers used for PCR analyses

From: Evaluation of commercial veterinary probiotics containing enterococci for transferrable vancomycin resistance genes

PrimersNucleotide sequence (5′-3′)Size of PCR product (bp)
16S rRNA12Forward: TGCCAGCAGCCGCGGTA (516f)
Reverse: GGTTACCTTGTTACGACTT (1510r)
994
ent13Forward: TACTGACAAACCATTCATGATG
Reverse: AACTTCGTCACCAACGCGAAC
112
vanA14Forward: AATACTGTTTGGGGGTTGCTC’
Reverse: CTTTTTCCGGCTCGACTTCCT
734
vanB14Forward: GCGGGGAGGATGGTGGGATAGAG
Reverse: GGAAGATACCGTGGCTCAAAC
420