Skip to main content

Table 1 Details of the 20 microsatellite primer pairs tested for cross-amplification in paca

From: Heterologous microsatellite primers are informative for paca (Cuniculus paca), a large rodent with economic and ecological importance

ID Sequence (5′ to 3′) Repeat motif Ta (ºC) Size range (bp) References
CUY5 F: GGCCAAAGCAGGAATGTCTA CA 55 141–163 Aviles et al. [24]
R: TAGGGCAAGCATTGATGATG
CUY6* F: TGGCTTGCTTTCTCTTTGGT CA 55 158–168
R: CTGTGCTCAGCATTGCATTT
CUY7 F: GATGCAGTGCAGAGGAGTCA CA 55 183–197
R: TGTGTGGTTTTGTGTGTGAGG
CUY8* F: TGATTGCACCTGAGAAGTGG TC 55 181–217
R: CCAAGTGTTCTTGGTGCTTG
CUY9 F: GCTGGAATGCAAGACAAGC GT 55 116–130
R: TGAGTTTTCAGCTGTGATGAGT
CUY10* F: TTCCAAGCATTTCAGAAAACA GT 55 106–128
R: TGACTTCCCAACCAAGGAAA
CUY17 F: TGATGGACAATATACTGGGAACC TC 55 152–170
R: TAGCATGCATGAAGCCCTAA
CUY18* F: TGTCACTTCTCACTCCACCA CA 55 176–214
R: TCCCAAACCTCTTGTTTGCT
CUY22 F: CGAACATGCCAAGCAGATTA TC 55 206–232
R: ACACCAGTTCCTTGCCACAT
CAVY2 F: GGCCATTATGCCCCCCAAC AC 55 124–154
R: AGCTGCTCCTTGTGCTGTAG
CAVY11* F: CCGTGCTTTTCCTGTCTTTG CT 55 140–180
R: TGGACCCCAATCTGACATAG
CAVY12 F: AGAATGCCTTTGGGACTGG AG 55 143–187
R: AGATCTTGCCTCTGCACTTG
CAPY1* F: GGAATTCCAAAAGACAACAGTTA (GT)12 59 185 Herrera et al. [26]
R: TCTCTCCTCAAAACAACAACAGA
CAPY4 F: ACACAGGTGCATTTGGCATA (GT)12 60 190–192
R: ATGAGGATGTGGCAGAAAGG
CAPY6 F: ATGGGGACTCCAGCAAGTTA (GT)5AT-(GT)7 56 289
R: AGATACATGCCTTCCCCAAA
CAPY7* F: CCTCAACATCCGTTTTCCTC (GT)16 60 272–278
R: CCCAAGGGTTGAAACACAGT
CAPY9 F: TGCCATTCTTGTGAAAGGTG (GT)17 60 152–162
R: TGCCCGTTTCAGTGTGTACT
CAPY10 F: CAAGGCTTCTGCTCACTCATT (GCT)9 56 182
R: TGAGGCATGCAAGAGCAA
CAPY12 F TGGGTGCCAGAATGCATAGTC (GT)10 61 195–197
R: GCATTGCCACCCCTACCTTA
CAPY24 F: TGCAGGGAGCACTTTATCCA (GT)7-TT-(GT)8 54 145–157
R: CAAGCTGGGCACAAAAAGGA
  1. The 12 primer pairs developed for guinea pigs (Aviles et al. [24]) and the 8 primer pairs developed for capybara (Herrera et al. [26]) are detailed in the table. Reported for each primer are the identification (ID), the forward primer sequence (F), the reverse primer sequence (R), the published annealing temperature (Ta), the published expected fragment size (bp), and original reference for these primers. An “*” highlights the seven of heterologous primer pairs that could not be consistently scored and interpreted. The repeat motif numbers were not reported in Aviles et al. [24]
\