Skip to main content

Table 2 Sequences of primers used for LAMP and PCR assay

From: Comparison of loop-mediated isothermal amplification and conventional PCR tests for diagnosis of common Brucella species

Assay Primer Sequence Amplicon size (bp) Reference
LAMP F3 5′‐GCTTTACGCAGTCAGACGT‐3′ 189 [25]
B3 5′‐GCTCATCCAGCGAAACGC‐3′
FIP 5′‐AGGCGCAAATCTTCCACCTTGCGCCTATTGGGCCTATAACGG‐3′
BIP 5′‐GGCGACGCTTTACCCGGAAATTCAGGTCTGCGACCGAT‐3′
LF 5′‐CCTTGCCATCATAAAGGCC‐3′
LB 5′‐CGTAAGGATGCAAACATCAA‐3′
PCR B4 5′-TGGCTCGGTTGCCAATATCAA-3′ 223 [15]
B5 5′-CGCGCTTGCCTTTCAGGTCTG-3′