Skip to main content

Table 2 PCR primers, melting temperature, and product size

From: Epigenetic mechanisms shape the underlining expression regulatory mechanisms of the STAT3 in multiple sclerosis disease

Primers Sequence Melting temperature Product Sizes (bp)
STAT3 MF TATCGTTTTTTGTATTCGTTTGTAC 58.2 192
MR CCTACTTTAAACTTCAATTTCTACGTA 59.0
UMF TTGTTTTTTGTATTTGTTTGTATGG 57.5  
UMR CCTACTTTAAACTTCAATTTCTACATA 57.5 190