Skip to main content

Table 1 Staphylococcus aureus strains, plasmids and primer used for this study

From: Staphylococcus aureus pigmentation is not controlled by Hfq

Strain nameKey featuresReference or construction
RN4220Transformable by DNA from E. coli[25]
SAPhB5RN4220 Δhfq::cat[13]
NCTC8325Clinical isolate[26]
SAPhB224NCTC8325 Δhfq::catNCTC8325 + ϕ11(SAPhB5)
NCTC8325-4NCTC8325 Δϕ11 Δϕ12 Δϕ13[27]
SAPhB197NCTC8325-4 Δhfq::catNCTC8325-4 + ϕ11(SAPhB5)
RN6390NCTC 8325-4 ϕ6390[28]
SAPhB22RN6390 Δhfq::cat[13]
HG001NCTC8325 rsbU repaired[22]
SAPhB199HG001 Δhfq::catHG001 + ϕ11(SAPhB5)
HG002NCTC8325 tcaR repaired[22]
SAPhB201HG002 Δhfq::catHG002 + ϕ11(SAPhB5)
HG003NCTC8325 rsbU and tcaR repaired[22]
SAPhB203HG003 Δhfq::catHG003 + ϕ11(SAPhB5)
COLMethicillin resistant clinical isolate[29]
SAPhB16COL Δhfq::cat[13]
NewmanClinical isolate[30]
SAPhB17Newman Δhfq::cat[13]
SAPhB142RN4220 pRMC2RN4220 + pRMC2
SAPhB248RN4220 pRMC2HfqRN4220 + pRMC2Hfq
SAPhB251RN4220 pRMC2HfqFLAGRN4220 + pRMC2HfqFLAG
SAPhB233HG003 pRMC2HG003 + pRMC2
SAPhB249HG003 pRMC2HfqHG003 + pRMC2Hfq
SAPhB257HG003 pRMC2HfqFLAGHG003 + pRMC2HfqFLAG
Plasmid nameKey featuresReference/construction
pRMC2Anhydrotetracycline (aTc) inducible promoter Pxyl/tetO[17]
pRMC2Hfqhfq inducible expressionSee “Methods
pRMC2FLAGpRMC2 derivative for translational gene fusions with 3xflag coding sequenceSee “Methods
pRMC2HfqFLAGhfq::3xflag inducible expressionSee “Methods
Primer nameSequencePurpose
39GGGGTACCATGATTGCAAACGAAAAChfq amplification (with a KpnI site)
49GGGGAATTCTTATTCTTCACTTTCAGTAGATGChfq amplification (with an EcoRI site)
856GGTACCGTTAACAGATCTGAGpRMC2 amplification
918GCTTATTTTAATTATACTCTATCAATGATAGAGpRMC2 and pRMC2FLAG amplifications
858TCAGATCTGTTAACGGTACCGGAATTAGCTTGCATGGAA3xflag amplification
919GATAGAGTATAATTAAAATAAGCGAGCTCGACTACAAAGACCA3xflag amplification
865GACTACAAAGACCATGACGGpRMC2FLAG amplification
939GATAGAGTATAATTAAAATAAGCGTAAAAGGAGTCCGACAGATGAhfq amplification for cloning in pRMC2FLAG
940CCGTCATGGTCTTTGTAGTCTTCTTCACTTTCAGTAGATGCTTGhfq amplification for cloning in pRMC2FLAG