Skip to main content

Table 1 Thirteen novel microsatellite markers developed for use in Somniosus microcephalus (n = 35)

From: Development and characterization of thirteen novel microsatellite markers for use in Greenland sharks (Somniosus microcephalus), with cross-amplification in Pacific sleeper sharks (Somniosus pacificus)

Locus Sequence (5′—> 3′) TA (°C) Range (bp) Motif NA
Smic1 F: TGCCTAGTAGACGCCCCTAA 52 157–189 CAGA 7
  R: TGTTCCCAGATGTGTGCATT     
Smic2 F: GCCTAAGCCACCCTCCTAAT 57 159–167 ACAG 2
  R: CTCCGGCATCTCCACACTAT     
Smic4 F: TATTTAGTCCCAGCAGTGCG 55 205–233 TGAC 6
  R: ACTTCGGCGACCATGTTCTA     
Smic5a F: TGTTTCAGGAATAGGGATGCC 55 224–244 TCAG 4
  R: CAATCATTTATCTTGTGGAGCCA     
Smic10 F: ATGCCTATGACACTCCCCTG 52 176–204 GACA 6
  R: ACCTGCCACCCGATTAGTAA     
Smic12 F: TGTCCGACCGAAACGTAAAT 52 173–189 AGAC 3
  R: CCCTCAGCAGAACCATTCAT     
Smic13 F: CCCATAAACAGCGAATGACC 55 152–164 AGAC 3
  R: GCCTTTGAACCAAGGACAGA     
Smic15 F: ATGCTTAGGACGGTTCTGGA 52 196–220 AGAC 6
  R: ATCCCTCATCCTGTGGACTG     
Smic16 F: CAGTGACAAACATCCCCAAA 52 220–236 ATAG 5
  R: AAACAGCCTTTCCCCGTCTA     
Smic18 F: ACGTAAATACGCCGATGACC 52 212–224 CAGA 4
  R: GGCCATGAACTTATCCTCCA     
Smic20 F: TCCGAACTCTTTTGGCTGAC 55 243–259 GACA 4
  R: CGTTCTCAGCTCAGGGATCT     
Smic24 F: TCACTGGTCCGTAATCGTCA 55 205–213 GACA 4
  R: CCACATCTTCCGGCTCTAAA     
Smic31 F: ATACGCTTATGACCGCTCCG 57 243–259 GACA 3
  R: GTCCAAAACACAGAGCAGGG     
  1. Includes: Locus name, forward (F) and reverse (R) primer sequences, annealing temperature (TA), fragment length range in base pairs, repeat tetrasat motif, total number of alleles (NA)
  2. a indicates presence of null alleles