Skip to main content

Table 1 Primers: Virulence genes of Staphylococcus aureus

From: Distribution of virulence genes and SCCmec types among methicillin-resistant Staphylococcus aureus of clinical and environmental origin: a study from community of Assam, India

Serial no. Primer pairs/ Target gene Sequence Length (bp) Reaction conditions Reference
1 icaA F GACCTCGAAGTCAATAGAGGT 814bp Initial denaturation-94°C/2min
\( \left. \begin{aligned} {\text{Denaturation}} - { 94}^\circ {\text{C}}/ 30{\text{ s}} \hfill \\ {\text{Annealing }} - { 46}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ {\text{Extension}} - { 72}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ \end{aligned} \right\}35\;{\text{cycles}} \)
Final Extension- 72°C/ 7 min
[31]
icaA R CCCAGTATAACGTTGGATACC
2 sea F TTGGAAACGGTTAAAACGAA 120bp [27]
sea R GAACCTTCCCATCAAAAACA
3 seb F TCGCATCAAACTGACAAACG 478bp [27]
seb R GCAGGTACTCTATAAGTGCC
4 eta F CTAGTGCATTTGTTATTCAA 119bp Initial denaturation-94°C/2min
\( \left. \begin{aligned} {\text{Denaturation}} - { 94}^\circ {\text{C}}/ 30{\text{ s}} \hfill \\ {\text{Annealing }} - { 46}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ {\text{Extension}} - { 72}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ \end{aligned} \right\}32\;{\text{cycles}} \)
Final Extension- 72°C/ 7 min
[27]
eta R TGCATTGACACCATAGTACT
5 etb F ACGGCTATATACATTCAATT 200bp [27]
etb R TCCATCGATAATATACCTAA
6 tst F ACCCCTGTTCCCTTATCATC 326bp [30]
tst R TTTTCAGTATTTGTAACGCC
7 cna F GTCAAGCAGTTATTAACACCAGAC 423bp Initial denaturation-95°C/2min
\( \left. \begin{aligned} {\text{Denaturation}} - { 95}^\circ {\text{C}}/ 30{\text{ s}} \hfill \\ {\text{Annealing }} - { 50}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ {\text{Extension}} - { 72}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ \end{aligned} \right\}32\;{\text{cycles}} \)
Final Extension- 72°C/ 7 min
[32]
cna R AATCAGTAATTGCACTTTGTCCACTG
8 fnbA F GTGAAGTTTTAGAAGGTGGAAAGATTG 643bp [33]
fnbA R GCTCTTGTAAGACCATTTTTCTTCAC
9 femB F TTACAGAGTTAACTGTTACC 651bp Initial denaturation-95°C/2min
\( \left. \begin{aligned} {\text{Denaturation}} - { 95}^\circ {\text{C}}/ 30{\text{ s}} \hfill \\ {\text{Annealing }} - { 44}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ {\text{Extension}} - { 72}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ \end{aligned} \right\}35\;{\text{cycles}} \)
Final Extension- 72°C/ 7 min
[29]
femB R ATACAAATCCAGCACGCTCT
10 nuc F GCGATTGATGGTGATACGGTT 270bp Initial denaturation-95°C/2min
\( \left. \begin{aligned} {\text{Denaturation}} - { 95}^\circ {\text{C}}/ 30{\text{ s}} \hfill \\ {\text{Annealing }} - { 49}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ {\text{Extension}} - { 72}^\circ {\text{C}}/ 1 {\text{ min}} \hfill \\ \end{aligned} \right\}35\;{\text{cycles}} \)
Final Extension- 72°C/ 7 min
[28]
nuc R AGCCAAGCCTTGAACGAACTAAAGC