Skip to main content

Table 2 Characterization of 29 microsatellite markers in Sumatran rhinoceros

From: Characterization of 29 polymorphic microsatellite markers developed by genomic screening of Sumatran rhinoceros (Dicerorhinus sumatrensis)

Locus Primer Sequence (5′–3′) A Size Range (bp) HE HO FIS PID PID(sib)
  Highly recommended        
Disu033 F: TCTGGATACCTGAGGCTTGAC 2 152–164 0.53 0.00 1.00 0.41 0.63
R: ACTGGCATCACTTCTTTCCC
Disu098 F: GCTAGGAGAGGGTGTTGGAC 4 98–126 0.78 0.20 0.76 0.14 0.44
R: TGGTAGCCTTGCCTCTTTCC
Disu100* F: TGTGGACTTGTCATATATGGGC 2 120–122 0.36 0.40 − 0.14 0.51 0.72
R: TTCATCCATGCTGTCACAAATG
Disu201 F: TGGAGAGAATTTCAGACATGGG 2 156–158 0.53 0.00 1.00 0.39 0.61
R: CTAGCCCAAGATCCATTGGC
Disu261 F: AAACCATACGCGGGAGAAGG 2 150–166 0.60 0.33 0.50 0.38 0.59
R: GAAGGGAAGATCATGCAGGAG
Disu393 F: AGTGAGCAAGGGAATGTGTG 2 155–157 0.36 0.40 − 0.14 0.51 0.72
R: GGGTGCTGTCTCTTGATTGG
Disu448* F: CAGGTTTCGTTACTGCAGGAC 2 154–156 0.20 0.20 0.69 0.83
R: TCTGGTGACCTGAGATGCAC
Disu476* F: AAACAGGGAAACAAGGTGCG 3 162–174 0.60 0.80 − 0.39 0.29 0.55
R: GACTGCGCCCTTTCTGTTAG
Disu487* F: TATCATGTCACAAGCACGCG 2 148–160 0.20 0.20 0.69 0.83
R: GTCTTCTTCACGACAGCACC
Disu783* F: CCTTGCCTTGCCTTCAATCC 3 126–134 0.51 0.60 − 0.20 0.34 0.61
R: CCATCCTTTCTCCTACACAGAC
Disu847 F: AAAGTCGCCTCTCACACACC 2 138–140 0.20 0.20 0.69 0.83
R: TCAGAGCCTCCTTGTAAGCG
  Recommended#        
Disu050 F: CTCCCACATTCAGCAAACTTTC 3 160–166 0.51 0.20 0.64 0.34 0.61
R: CCAGGCAGTGATGACTCTAC
Disu071 +  F: TTGAGATGCATTGCCGTGG 3 168–172 0.73 0.33 0.60 0.23 0.50
R: CCATGGTTTCTGCATCGTGG
Disu076 +  F: TTCCAGCCGCTCTTATGACC 2 125–129 0.53 0.00 1.00 0.41 0.63
R: TCATGTGCTTATTGGCCATCTG
Disu127 F: CCACCACCACCATGCATAG 2 162–164 0.36 0.00 1.00 0.51 0.72
R: CATTTGCTCCCATGCTGAAG
Disu138 F: GGGACACATGACTCCTCTTATC 2 167–169 0.53 0.00 1.00 0.41 0.63
R: CCACTCCACCTTATACTACCAC
Disu149 F: GAGCGTGCATGGTAGTTTCC 4 160–168 0.73 1.00 − 0.43 0.18 0.47
R: GGTTCTCATAGCAGACGGAG
Disu151 +  F: CATTGTGCTCGCTACGCAG 2 135–137 0.36 0.00 1.00 0.51 0.72
R: CTAGGTGTCAAGAGCCAGGG
Disu480 F: CCTGCCTTCTAGTCCTGTGG 2 112–116 0.47 0.20 0.60 0.42 0.65
R: AGCAAGCAGGATCAGGAAGG
Disu501 F: TGGCCACATCTTCAGCATTAAG 2 155–157 0.47 0.60 − 0.33 0.42 0.65
R: GCACCTAACACAGTTACAGGC
Disu542 +  F: AAACTACAGGCACGTACAGC 2 128–130 0.20 0.20 0.69 0.83
R: TTGAGAGATGAGGTGCGGTC
Disu545 F: TGTTGTCCAAGCTGTGTCTG 2 148–150 0.20 0.20 0.69 0.83
R: TGGCAGCTGGTACCTAACAG
Disu556 +  F: GCCAATTAAATCTACCTGCCAC 2 168–174 0.25 0.25 0.63 0.80
R: GCCAAGACTCAAACCCAGG
Disu582 F: TCTGTGGTGGTAGCTGTGAC 2 144–152 0.36 0.00 1.00 0.51 0.72
R: TGGCACAGAGACACCCATG
Disu593 +  F: CCACGTCCCAGGTCAAGAG 3 164–166 0.56 0.20 0.67 0.38 0.59
R: AGCTGTTCCTGGTGGCTC
Disu733 F: TGGCACAGAGACACCCATG 2 151–159 0.36 0.00 1.00 0.51 0.72
R: TCTGTGGTGGTAGCTGTGAC
Disu748 F: CCTTGATTGGTGGGTTCCC 3 106–116 0.64 0.80 − 0.28 0.26 0.53
R: AGAGAGAGCGCACGTGTG
  Not recommended        
Disu269 + a F: CAAGACCACACCTGCTTGTC 3 115–152 0.60 0.33 0.50 0.30 0.58
R: ACTCACTCATCACCCAGCC
Disu863 + b F: GAAGCTGTATGTCCGGATGC 2 162–166 0.36 0.40 − 0.14 0.51 0.72
R: GCTAAACAGACCTTCCTCAGAG
  1. A is the number of alleles per locus, HE and HO are expected and observed heterozygosity, respectively. PID is the probability of identity and PID(sib) is the probability of identity between siblings. FIS reflects deviation from Hardy–Weinberg proportions. Results are based on samples of six individuals initially tested. Among the highly recommended markers, an asterisk (*) indicates those that produced exceptionally good results. A dagger () indicates that primers amplify tapir amplicons (though with very different sizes than for rhino); species identity may be established with mtDNA. A plus sign ( +) indicates primers that may amplify human DNA (see Table S4 for differences in size range). The primers listed as "recommended" (#) may be subject to further improvement with additional optimization. Reasons primers were not recommended: a-failed to amplify; b-lack polymorphism in Indonesian samples. The size range includes an M13 forward sequence (TGTAAAACGACGGCCAGT) added to the 5′ end of each forward primer (but not shown as part of the forward primer sequences above). The PID and PID(sib) are calculated by the method of Waits et al. 2001 (reference 20)