Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Antibiotic resistance, biofilm formation, and biofilm-associated genes among Stenotrophomonas maltophilia clinical isolates

Genes Sequences (5’→3’) Target References
16srRNA-F AGTTCGCATCGTTTAGGG 16 s RNA [2]
16srRNA-R ACGGCAGCACAGAAGAGC
spgM-F ATACCGGGGTGCGTTGAC spgM [18]
spgM-R CATCTGCATGTGGATCTCGT
rpfF-F CACGACAGTACAGGGGACC rpfF [18]
rpfF-R GGCAGGAATGCGTTGG
rmlA-F CGGAAAAGCAGAACATCG rmlA [3]
rmlA-R GCAACTTGGTTTCAATCACTT