Skip to main content

Table 1 Sequence of primers used in qPCR in cell line

From: Evaluation of E. coli Nissle1917 derived metabolites in modulating key mediator genes of the TLR signaling pathway

Genes Name Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Refs.
TLR-1 GCCCAAGGAAAAGAGCAAAC AAGCAGCAATATCAACAGGAG [43]
TLR-2 TCTCCCATTTCCGTCTTTTT GGTCTTGGTGTTCATTATCTTC [43]
TLR-3 TAAACTGAACCATGCACTCT TATGACGAAAGGCACCTATC [18]
TLR-4 GAAGCTGGTGGCTGTGGA GATGTAGAACCCGCAAG [18]
TLR-5 TTGCTCAAACACCTGGACAC CTGCTCACAAGACAAACGAT [18]
TLR-6 GTGCCATTACGAACTCTA TTGTTGGGAATGCTGTT [18]
TLR-7 CTGACCACTGTCCCTGAG AACCCACCAGACAAACCA [18]
TLR-8 AACATCAGCAAGACCCAT GACTCCTTCATTCTCCCT [18]
TLR-9 CGCCAACGCCCTCAAGACA GGCGCTTACATCTAGTATTTGC [18]
Myd88 TGGCCTTGTTAGACCGTGA AAGTATTTCTGGCAGTCCTCCTC [44]
IRAK1 AGGTTTCGTCACCCAAACATT CGGGCTGTACCCAGAAGGA [45]
IRAK4 CCTGACTCCTCAAGTCCAGAA ACAGAAATGGGTCGTTCATCAAA [46]
MAPK GACGAGGAGCTTATGGTTCTGT TTTTCATCCACTGTTGACCGAA [47]
NFkB GTCAAAAACGCCACCTCTCAA CTCGCATGGAATTTGGAACCG [22]
TAB2 CTCCTGGTGGTACAACTCGAC TGATTTGGCTGTTGAGATGAGG [48]
IFN-β CAACTTGCTTGGATTCCTACAAAG TATTCAAGCCTCCCATTCAATTG [48]
Β-actin AACCGTGAAAAGATGACCCAGAT CACAGCCTGGATGGCTACGT [19]
GAPDH AACGGGAAGCTTGTCATCAATGGAAA GCATCAGCAGAGGGGGCAGAG [18]