Skip to main content

Table 1 Molecular markers associated with G gene for seed coat colour in flax

From: Fine-mapping of a putative glutathione S-transferase (GST) gene responsible for yellow seed colour in flax (Linum usitatissimum)

Marker Primer sequence Scaf-fold number Physical location on scaffold (bp) Physical location Chr 6 (bp) Genetic distance from G gene (cM)
Lu442 F: TCCGTGTAGAAGAAACGAGGA
R: CCGACCTCTTGCCATGATTA
25 1,636,327   29.4
Lu69 F: CTAAACCACACCCCCATCAC
R: AAAGTGGGGAAATTGGGCTA
352 68,959–69,164 10,960,833–10,961,358 18.6
KASP5 A1: GTTCAAGCTTCCTAAGCAGGCG
A2: GGTTCAAGCTTCCTAAGCAGGCA
C1: GGTGGTTAGATTCCTGGCCGGAA
176 258,853–258,911 15,065,122–15,065,180 11.1
KASP6 A1: ATCTGTAATCTAACGTCCGAGCAGT
A2: GATCTGTAATCTAACGTCCGAGCAAC
C1: CCATACAAAATCTCAATTCGACGCTTCTA
176 485,174–485,241 14,838,792–14,838,886 7.9
KASP20 A1: CTCCGTTTCATTATAGAATTGCTGGATTCA
A2: CTTCGTTTCATTATAGAATTGCTGGATTCT
C1: CTAGCACAAAATTAACCAGACTATGTAGA
1491 5180–5380 14,320,238–14,320,179 4.5
KASP28 A1: ACGATCGAAAGAGGAAGCTCG
A2: ACGATCGAAAGAGGAAGCTCA
C1: TACATGCATATGGCTAGCTACACTT
1491 501,848–501,870 13,793,920–13,794,025 0.6
KASP22 A1: GGTAGCTAGAGTTAGCTCATGATGA
A2: GTAGCTAGAGTTAGCTCATGATGG
C1: CTACTATCACATAGCTTTGAGCTACACTT
618 47,530–47,737 13,450,328–13,450,385 4.2
KASP21 A1: ACCCAATCAGCTCTGGATTTGTTTAA
A2: ACCCAATCAGCTCTGGATTTGTTTAT
C1: CTTGCCAGAAATCCAATACCGTCTCAA
618 538,471–538,670 12,959,816–12,959,880 7.7
HRM LG6:13,446 F: CTCTGCTTTACTACTCTTTACTCT
R: AGTTCTAATATGAAATCAGAGGGG
   13,446,488–13,446,617  
HRM LG6:13,593 F: TGACACTATTGTAGGATTTGTTTCT
R: CGTCGAATTAATCTCTACCTGAAT
   13,593,300–13,593,430  
HRM LG6:13,937 F: ACAGAGAAACATCAATCGAAATCT
R: CATTTGCTTCGGCTTATTTGC
   13,936,796–13,936,923  
HRM LG6:13,942 F: GAAGGTATTGGAAATGGACCATAT
R: TACAAGAAAAGCAGAGCAACTTAT
   13,941,869–13,941,995  
HRM LG6:14,010 F: CTTGCCCATTTCCTCCATTATTTT
R: AAGATTAGAAATCAAAGTACGGCA
   14,009,768–14,009,893  
  1. Scaffold number and location are based on reference genome sequence version 1.0 (available at phytozome-next.jgi.doe.gov/info/Lusitatissimum_v1_0). Physical coordinates on Chr 6 are based on pseudomolecule sequence CP027630.1 in NCBI. The putative G gene is located at 13,779,760–13,782,089 of Chr 6. Genetic distances between markers and G gene were determined using Kosambi’s mapping function
  2. F forward primer; R reverse primer; A1 allele specific primer 1 A2 allele specific primer 1 C1 common primer