Skip to main content

Table 1 Primers used for Dirofilaria species identification

From: A study on canine dirofilariasis in selected areas of Sri Lanka

Primer pair Primer sequence Gene target Product origin Product size (base-pairs) Reference
D.imm-F1 CATCAGGTGATGATGTGATGAT ITS 2 D. immitis 302 [17]
D.imm-R1 TGATTGGATTTTAACGTATCATT
DIR 3 CCGGTAGACCATGGCATTAT 5S rRNA D. repens 246 [18]
DIR 4 CGGTCTTGGACGTTTGGTTA
  1. ITS internal transcribed spacer, 5S rRNA ribosomal 5S ribonucleic acid.