Open Access

Update on comparative genome mapping between Malus and Pyrus

  • Jean-Marc Celton1, 2,
  • David Chagné2,
  • Stuart D Tustin3,
  • Shingo Terakami4,
  • Chikako Nishitani4,
  • Toshiya Yamamoto4 and
  • Susan E Gardiner2Email author
BMC Research Notes20092:182

DOI: 10.1186/1756-0500-2-182

Received: 11 June 2009

Accepted: 14 September 2009

Published: 14 September 2009

Abstract

Background

Comparative genome mapping determines the linkage between homologous genes of related taxa. It has already been used in plants to characterize agronomically important genes in lesser studied species, using information from better studied species. In the Maloideae sub-family, which includes fruit species such as apple, pear, loquat and quince, genome co-linearity has been suggested between the genera Malus and Pyrus; however map comparisons are incomplete to date.

Findings

Genetic maps for the apple rootstocks 'Malling 9' ('M.9') (Malus × domestica) and 'Robusta 5' ('R5') (Malus × robusta), and pear cultivars 'Bartlett' and 'La France' (Pyrus communis) were constructed using Simple Sequence Repeat (SSR) markers developed from both species, including a new set of 73 pear Expressed Sequence Tag (EST) SSR markers. Integrated genetic maps for apple and pear were then constructed using 87 and 131 SSR markers in common, respectively.

The genetic maps were aligned using 102 markers in common, including 64 pear SSR markers and 38 apple SSR markers. Of these 102 markers, 90 anchor markers showed complete co-linearity between the two genomes.

Conclusion

Our alignment of the genetic maps of two Malus cultivars of differing species origin with two Pyrus communis cultivars confirms the ready transferability of SSR markers from one genus to the other and supports a high level of co-linearity within the sub-family Maloideae between the genomes of Malus and Pyrus.

Findings

Comparative genomics involves the assessment of the degree of genomic conservation between species to enable the transfer of genetic information, such as the position of major genes, quantitative trait loci (QTL), and candidate genes, in order to validate their role. Practically, comparative genome mapping determines the linkage between homologous genes of related taxa by aligning genome maps using orthologous molecular markers, which can greatly assist in genetic analysis of less-studied species. It is often measured by the degree of synteny, that is, the conservation of gene content, and co-linearity, which represents the conservation of gene order between conserved genomic regions. The first example of genome comparison in plants was made between tomato and potato and used conserved restricted fragment length polymorphism (RFLP) probes [1] to reveal a high degree of co-linearity between these species.

The Maloideae sub-family includes fruit species such as apple, pear, loquat and quince. Apple (Malus × domestica) and pear (Pyrus species) are major temperate fruit crops that have been cultivated in Europe and Asia for at least 2,000 to 3,000 years [2]. Molecular markers linked to a number of agronomically important traits, such as resistance to pests and diseases, tree architecture, and fruit quality, have been identified in both apple [3] and pear [4]. Their identical chromosome number (2n = 2x = 34) and similar genome size (apple 1.57 pg/2C [5]; pear 1.11 pg/2C) [6], as well as their supposed recent divergence date (33.9 to 55.8 million years ago [7]) suggests that their genomes might be highly co-linear. When co-linearity between Malus and Pyrus was examined by comparing maps of the European pears (Pyrus communis) 'Bartlett' and 'La France', and the Japanese pear (Pyrus pyrifolia) 'Housui' with those of apple cultivars (Malus × domestica) 'Fiesta' and 'Discovery' [8] using 66 transferable apple simple sequence repeat (SSR) loci, all the pear linkage groups were aligned to the apple consensus linkage groups with at least one marker in common [9]. These results showed that positions of SSR loci are well conserved between apple and pear, suggesting that partial co-linearity exists between the genera. A study by [10] reported that more than 100 apple SSR markers could be positioned on pear genetic linkage maps. [11] described the mapping of six pear SSR loci on the linkage maps of apples 'Fiesta' and 'Discovery', and their location in homologous linkage groups. This was confirmed in a later study based on a larger set of pear SSR markers mapped in a 'Malling 9' × 'Robusta 5' ('M.9' × 'R5') apple rootstock population [12].

Here we report on a detailed comparison of the apple and pear genomes using a new set of transferable SSR markers developed from pear coding sequences.

Methods

Plant material

The genetic maps that were used as framework maps for positioning the new markers have previously been described. Construction of the genetic map of the European pear cultivars 'La France' and 'Bartlett' is described in [9]. The apple rootstock genetic linkage maps constructed in 'M.9' (Malus × domestica) and 'R5' (Malus × robusta) are described in [12]. The new SSR markers were screened over 60 F1 individuals from the 'M.9' × 'R5' population, consisting of the bin mapping set [12] of 14 plants together with 46 additional seedlings.

SSR markers

Seventy-three new SSR markers developed from pear EST were tested for their amplification and segregation in the 'M.9' × 'R5' apple population. These markers are prefixed by TsuENH and their PCR primer sequence and accession of the EST are given in Table 1. PCR amplifications were performed as described in [13] with the modifications described in [12]. PCR fragments were separated as described in [9] and [12] for pear and apple, respectively.
Table 1

List of pear EST-based SSR markers tested in apple.

SSR locus

accession

Location on pear

consensus map

Location on

apple

consensus map

Forward primer (5'-3')

Reverse primer (5'-3')

TsuENH001

AB450689

LG2

LG2

AAAGACGGCATTGACTGGATAGA

gtttcttGATGCAAAGACTTTCGCCTATCT

TsuENH004

AB450692

LG4, 12

LG4

CGCATTAAAGTCTGGCTTTCTTC

gtttcttGAATTGGCAGAGAGATTGAGTGG

TsuENH008

AB450696

LG9

LG13

CTGAGGTCTCATTCGGTGATTCT

gtttcttCCTTCTCTGCTTTCTTCTTCACG

TsuENH011

AB450698

LG6, 14

LG6

CGCTTATCCGTTAAACTTCA

gtttcttCAACGACAGTTCGAATAGGA

TsuENH016

AB450701

LG15

LG15

TCATTTCATGGACTCTCAATCTCC

gtttcttCGAGGAGTCTGTCTGCGTCT

TsuENH022

AB450705

LG16

LG16

CCAATTCATCGAAGTTTACATAGGG

gtttcttGGCCAAAGTGCATGAGATGTAGT

TsuENH023

AB450706

LG3

LG3

TCTTCTTCACAGGTCACAACAGC

gtttcttCTATGCGCTGCTTCTTGGTAGTC

TsuENH031

AB450711

LG14

LG14

CATTTCCTTAGCTCCCTCCAGTT

gtttcttGAACCTTCCTCTTCCCATCACTT

TsuENH032

AB450712

LG14

LG14

AACTGGAGGGAGCTAAGGAAATG

gtttcttCATCAAACAAAACTAGCCGAACC

TsuENH033

AB450713

LG17

LG17

CCTGAGGTTATTGACCCAAAAGA

gtttcttGGTGGATACTCACTCAGTTGGAAA

TsuENH034

AB450714

LG8

LG8

GCCCCCAATATTTTCCCATTAT

gtttcttGTTGGTGTTTGAGTCAACGTGAG

TsuENH042

AB450718

LG13, 16

LG16

AAAGCCGTACATTAGGCAAACC

gtttcttAAAACTAGAACAGGCAGCCACAG

TsuENH043

AB450719

LG10

LG10

CATCTGCGTCCGGCAAAC

gtttcttGCCCCCTGATATTCGTGGAT

TsuENH046

AB450722

LG6

LG6

GGTCATCACCCACTTAAAAACCA

gtttcttGTGCCCTGAAGTAATTGAGATGG

TsuENH049

AB450724

LG1

LG1

CATCAGCCTACGAGCACATACAC

gtttcttAGATTACGGCAACAGCAACAGAT

TsuENH052

AB450726

 

LG13, LG16

CCCAGCAGCCTCCTAATCAATA

gtttcttTAGTTGTAGTCCTGCCCAAGTCC

TsuENH058

AB450730

LG14

LG14

AGAAGAAGGATAAGAAGAAGGATGG

gtttcttGTAACGAAAAGGAAACAGGACTTG

TsuENH060

AB450732

 

LG10

ATCTCCACCCAAGAAACCTTACC

gtttcttGGGGGTGAGGAATAGATGTAACC

TsuENH062

AB450733

LG2

LG2

ACTCAGATCGTACGCAGAACAAA

gtttcttCGATAAAGATCGATAATCCTCATGC

TsuENH066

AB450736

 

LG13

GTGGTGGAGGTGCGTATTGAC

gtttcttCGAGGAAAAGTGCGACTCGT

TsuENH068

AB450738

 

LG5

CCAATTTTCTCTTCCTCCCTGTT

gtttcttTTACAGTTATTGCCGAAGCCAAG

TsuENH076

AB450743

 

LG10

CATTAATACGCTGCTGTTTCTGC

gtttcttACTTGAATTGGGGTAGGGATTGT

TsuENH079

AB450745

LG16

LG13

GCGGCTTCTTGGGAGAAGGT

gtttcttGCATGCTCCTTTTGACAGCCTAC

TsuENH081

AB450747

 

LG13

GCTCTCCTCTTCTTCTCCCACTC

gtttcttCCACCCTCGTCAAAATCAGAGTA

TsuENH082

AB450748

 

LG11

CACCAGTACTCCTGGAGGGTTTC

gtttcttGTGCTCCTGCAACATTTTCTCC

TsuENH083

AB450749

LG11

LG11

ACTCTCCGCAAAACAATGTCGTA

gtttcttTGTGAGAGTTTGAGGAGGAGAGC

TsuENH086

AB450751

LG5

LG5

CTCTGTTCTGCTTCGATTCTGCT

gtttcttGTCCACGTTCACCATTTTTCAGT

TsuENH093

AB450757

LG15

LG8, LG15

GTGGAGATTTTCCGAGTCAAATG

gtttcttAATAAGACTGCTGAGGGAATCCA

TsuENH096

AB450759

LG15

LG8

AGTGAGAGAGAGAGGCCTTGGTT

gtttcttGCTCTTGCTCTGTCTTCGAAATG

EST: expressed sequence tag. SSR: single sequence repeat. LG: linkage group.

Linkage analysis and map integration

The new EST-based SSR markers were positioned on the parental apple and pear genetic maps using JoinMap v3.0 software [14] with a minimum LOD score of 5.0 for grouping using the Kosambi function. Integrated consensus genetic maps were constructed by merging the 'M.9' and 'R5' datasets for apple, and the 'La France' and 'Bartlett' datasets for pear, using the "combine" function of JoinMap v3.0. This merging method is based on the calculation of mean recombination frequencies and combined LOD scores. Graphical representations of the maps were drawn using MapChart v2.0 [15]. For the integration of the female and male maps, SSR markers in common among homologous linkage groups were used for the analysis, and all apple SSR markers mapped on pear, as well as all pear SSR markers mapped on apple, were included. Other types of markers, such as amplified fragment length polymorphisms (AFLP), single nucleotide polymorphisms (SNP), sequence characterized amplified regions (SCAR), and isozymes were removed from the map, except when located in large gaps between SSR markers, or at the extreme end of a linkage group.

Results

Pear EST-SSR polymorphism

All 73 pear SSR markers developed from pear expressed sequence tags (EST) amplified a PCR product when tested on apple and 29 (40%) were polymorphic in the 'M.9' × 'R5' population (Table 1). Two markers, TsuENH052 and TsuENH093, amplified two loci in apple. Nineteen and 22 pear EST-SSR markers were mapped on 'M.9' and 'R5', respectively, bringing the total number of pear markers mapped on 'M.9' to 51 and 'R5' to 61 [12]. The integrated consensus 'M.9' × 'R5' map contained a total of 96 SSR loci derived from 90 primer pairs developed from either pear genomic DNA or EST.

Genetic map integration and comparison

Integrated consensus maps for apple ('M.9' and 'R5') and pear ('La France' and 'Bartlett') were constructed using 87 and 131 markers in common between the respective parents of the mapping populations. The 'M.9' × 'R5' population generated a map of 1,230 cM, whereas the integrated map of pear was shorter, at 1,146 cM.

The alignment of the integrated pear and apple maps was performed using 102 SSR markers in common (Additional file 1). Of these 102 markers, 90 (53 pear and 37 apple SSR) mapped at similar locations on homologous linkage groups in apple and pear, and three mapped in what are considered to be homoeologous linkage groups (i.e. LG 13 and LG 16; Figure 1). Eight SSR markers in common between apple and pear were mapped in non-homologous and non-homoeologous linkage groups (Table 2).
https://static-content.springer.com/image/art%3A10.1186%2F1756-0500-2-182/MediaObjects/13104_2009_Article_320_Fig1_HTML.jpg
Figure 1

Alignment of pear and apple linkage groups (LG) 13 and 16 showing inter-specific co-linearity and intra-specific LG homeology. Alignment of the apple (M.9 R5) and pear (B LF) consensus genetic maps. SSR markers in common between the linkage groups are linked to each other with a line and are presented in color. SSR markers developed from apple sequences are in green while SSR markers developed from pear sequences are in red. M.9: 'Malling 9'. R5: 'Robusta 5'; B: 'Bartlett'. LF: 'La France'. SSR: single sequence repeat.

Table 2

SSR markers mapping in non-homologous and unknown homoeologous linkage groups in apple and pear

 

Apple LG

Pear LG

CH-Vf1

1

10

NH041a

5/10

7

NH027a

6

15

NB104a

9

12

NH045

11

10

TsuENH008

13

9

NB111a

15

11

NH013a

17

1

SR: single sequence repeat. LG: linkage group.

Discussion

Apple and pear genome synteny

Alignment of the genetic linkage maps made it possible to validate a high degree of co-linearity between the apple and pear genomes (Additional file 1). All pear linkage groups could be successfully aligned to the 'M.9' × 'R5' consensus map by at least one SSR marker. The whole of the pear LG 8 and LG 15 could be aligned to their apple homologues using five and six SSR markers, respectively. Other pear linkage groups, such as LG 2, LG 4, LG 10, LG 14 and LG 16 were partially aligned to the apple consensus map (Additional file 1). Other portions of the genomes, such as LG 7, the top of LG 3 and LG 6, and the bottom of LG 12 and LG 14 still remain incompletely aligned, and these should become the focus of future research aimed at aligning the complete apple and pear genomes at the level of genetic markers.

In most instances, the order and distances between individual markers were similar for apple and pear, suggesting the presence of regions that are highly conserved between the two genomes. Some SSR markers demonstrated multi-locus amplification across the two genera, such as CH05c06, NH044b, NB133a, TsuENH042, TsuENH079 and TsuENH052, that mapped on both LG 13 and LG 16 in both apple and pear (Figure 1). A few apparent inversions in marker order can be observed in Additional file 1: (i) LG 1, KA4b is above TsuENH049 in pear; (ii) LG 2, TsuENH062 is above BGT23b in pear; (iii) LG 9, CH05c07 and CH01f03b are inverted in pear with respect to apple; (iv) LG 11, CH04h02 and TsuENH083 are inverted in pear; (v) LG 12, NH207a is above NZ28f04 in pear. These apparent inversions may be a consequence of the relatively small number of individuals used to map these markers, 55 to 63 individuals in the pear population, and 60 individuals for apple. The number of progeny individuals genotyped in the mapping populations will need to be increased in future studies in order to validate these possible marker inversions. Overall, a high level of co-linearity between apple and pear genetic maps was confirmed.

As shown in Table 2, eight SSR markers mapped to non-homologous and possible uncharacterized homoeologous linkage groups in apple and pear. Fragments obtained from PCR amplification of four loci (NH013a, NH045a, NB104a and TsuENH008) using apple DNA were cloned and sequenced (data not shown). Their sequences were checked for the presence of a SSR motif and then compared to the original pear sequence when available. The amplification products obtained in apple using NH013a, NH045a and TsuENH008 contained a SSR motif, whereas NB104a did not. The sequence for pear and apple NH013a and NH045a were highly similar, except at the level of the SSR motif, which was shorter for apple than pear for both loci. The apparent change in map location does not correspond to unspecific PCR amplification, but could have resulted from small regions of genome re-organization in apple and pear. However, the current density of markers in common between the two integrated maps presented in this study does not allow such an interpretation of the results for the present.

Genome synteny in the Maloideae

Extensive comparative mapping studies in plant families such as Solanaceae, Poaceae and Brassicaceae have consistently indicated that genome evolution within a family consists mainly of limited chromosome rearrangements, leading to the conservation of large chromosome fragments. Similar results have already been found in the Rosaceae within the genus Prunus [16, 17], and have resulted in the complete alignment of the peach and apricot genomes [18]. Within the Maloideae, the results of our study confirm the high level of co-linearity between Malus and Pyrus genomes proposed by [2]. It is possible that further comparative mapping studies among other members of the Maloideae, such as loquat and quince, will demonstrate that all members of this family should be considered as a single genetic system. SSR markers from Malus have been used to construct the first genetic linkage map of loquat (Eriobotrya japonica) [19] and to conduct a diversity study in quince (Cydonia oblonga) [20].

These findings could be the precursor to the development of a set of genetic markers common to all members of the Maloideae. Markers with multi-locus amplification across two genera, such as observed for CH05c06, NH044b, NB133a, TsuENH042, TsuENH079 and TsuENH052 that mapped on homeologous linkage groups LG 13 and LG 16 in both apple and pear (Figure 1), would be invaluable for this purpose. A comprehensive marker set would enable a more efficient identification of loci for disease resistance and quality traits using comparative genome mapping across the Maloideae.

Conclusion

We have extended the list of SSR markers used for comparative genome mapping in the Maloideae, specifically for Malus and Pyrus. As the apple whole genome sequence will be available soon, we propose that apple should be used as the model for species in the Maloideae and that genetic information can be inferred in the other species by comparison of their genetic maps with that of apple. Furthermore, we suggest that this approach may be extended to include other members of the Rosaceae, such as Prunus, Rubus and Rosa.

Declarations

Acknowledgements

This worked was funded by a grant (contract number PREV0401) from the New Zealand Foundation for Research, Science and Technology, and Prevar™ Limited, HortResearch internal funding and by a grant from the Ministry of Agriculture, Forestry and Fisheries of Japan (Genomics for Agricultural Innovation, DD-4040).

We thank Dr VGM Bus, JM Bushakra and RV Espley for helpful editing of the manuscript.

Authors’ Affiliations

(1)
University of Western Cape, Biotechnology Department
(2)
The New Zealand Institute for Plant & Food Research Limited
(3)
The New Zealand Institute for Plant & Food Research Limited
(4)
National Institute of Fruit Tree Science

References

  1. Bonierbale MW, Plaisted RL, Tanksley SD: RFLP maps based on a common set of clones reveal modes of chromosomal evolution in potato and tomato. Genetics. 1988, 120 (4): 1095-1103.PubMed CentralPubMedGoogle Scholar
  2. Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg Van de E, Hayashi T: Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004, 663: 51-56.View ArticleGoogle Scholar
  3. Gardiner SE, Bus VGM, Rusholme RL, Chagné D, Rikkerink EHA: Genome mapping and molecular breeding in plants. Fruit and Nuts. Edited by: Kole C. 2007, Springer, Berlin, 4: 1-62.View ArticleGoogle Scholar
  4. Itai A: Genome mapping and molecular breeding in plants. Fruit and Nuts. Edited by: Kole C. 2007, Springer, Berlin, 4: 157-170.View ArticleGoogle Scholar
  5. Tatum TC, Stepanovic S, Biradar DP, Rayburn AL, Korban SS: Variation in nuclear DNA content in Malus species and cultivated apples. Genome. 2005, 48: 924-930.View ArticlePubMedGoogle Scholar
  6. Arumanagathan K, Earle ED: Nuclear DNA content of some important plant species. Plant Mol Biol Rep. 1991, 9: 229-241. 10.1007/BF02672073.View ArticleGoogle Scholar
  7. Wolfe JA, Wehr W: Rosaceous Chamaebatiaria -like foliage from the paleogene of western North America. Aliso. 1988, 12: 177-200.Google Scholar
  8. Liebhard R, Koller B, Gianfranceschi L, Gessler C: Creating a saturated reference map for the apple (Malus × domestica Borkh.) genome. Theor Appl Genet. 2003, 106: 1497-1508.PubMedGoogle Scholar
  9. Yamamoto T, Kimura T, Terakami S, Nishitani C, Sawamura Y, Saito T, Kotobuki K, Hayashi T: Integrated genetic linkage maps for pear based on SSR and AFLP markers. Breeding Science. 2007, 57: 321-329. 10.1270/jsbbs.57.321.View ArticleGoogle Scholar
  10. Pierantoni L, Cho K-H, Shin I-S, Chiodini R, Tartarini S, Dondini L, Kang S-J, Sansavini S: Characterisation and transferability of apple SSRs to two European pear F1 populations. Theoretical and Applied Genetics. 2004, 109: 1519-1524. 10.1007/s00122-004-1775-9.View ArticlePubMedGoogle Scholar
  11. Silfverberg-Dilworth E, Matasci CL, Weg Van de WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, et al: Microsatellite markers spanning the apple (Malus × domestica Borkh.) genome. Tree Genetics and Genomes. 2006, 2 (4): 202-224. 10.1007/s11295-006-0045-1.View ArticleGoogle Scholar
  12. Celton J-M, Tustin DS, Chagné D, Gardiner SE: Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009, 5: 93-107. 10.1007/s11295-008-0171-z.View ArticleGoogle Scholar
  13. Gianfranceschi L, Seglias N, Tarchini R, Komjanc M, Gessler C: Simple sequence repeats for the genetic analysis of apple. Theoretical and Applied Genetics. 1998, 96 (8): 1069-1076. 10.1007/s001220050841.View ArticleGoogle Scholar
  14. Van Ooijen JW, Voorrips RE: JoinMapR 3.0: Software for the calculation of genetic linkage maps. Wageningen, The Netherlands. 1998Google Scholar
  15. Voorrips RE: MapChart version 2.0: windows software for the graphical presentation of linkage maps and QTLs. Plant Research International, Wageningen, The Netherlands. 1998Google Scholar
  16. Dirlewanger E, Graziano E, Joobeur T, Garriga-Caldere F, Cosson P, Howad W, Arus P: Comparative mapping and marker-assisted selection in Rosaceae fruit crops. PNAS. 2004, 101 (26): 9891-9896. 10.1073/pnas.0307937101.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Vilanova S, Sargent D, Arus P, Amparo M: Synteny conservation between two distantly-related Rosaceae genomes: Prunus (the stone fruits) and Fragaria (the strawberry). BMC Plant Biology. 2008, 8: 67-10.1186/1471-2229-8-67.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R: Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007, 3: 239-249. 10.1007/s11295-006-0059-8.View ArticleGoogle Scholar
  19. Gisbert AD, Martinez-Calvo J, Llacer G, Badenes ML, Romero C: Development of two loquat [Eriobotrya japonica (Thunb.) Lindl.] linkage maps based on AFLPs and SSR markers from different Rosaceae species. Molecular Breeding. 2009, 23: 523-538. 10.1007/s11032-008-9253-8.View ArticleGoogle Scholar
  20. Yamamoto T, Kimura T, Soejima J, Sanada T, Ban Y, Hayashi T: Identification of quince varieties using SSR markers developed from pear and apple. Breeding Science. 2004, 54 (3): 239-244. 10.1270/jsbbs.54.239.View ArticleGoogle Scholar

Copyright

© Gardiner et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement