Open Access

Characterization of variable EST SSR markers for Norway spruce (Picea abies L.)

  • Silvia Fluch1Email author,
  • Agnes Burg1,
  • Dieter Kopecky1,
  • Andreas Homolka1,
  • Nadine Spiess1 and
  • Giovanni G Vendramin2
BMC Research Notes20114:401

DOI: 10.1186/1756-0500-4-401

Received: 31 May 2011

Accepted: 12 October 2011

Published: 12 October 2011

Abstract

Background

Norway spruce is widely distributed across Europe and the predominant tree of the Alpine region. Fast growth and the fact that timber can be harvested cost-effectively in relatively young populations define its status as one of the economically most important tree species of Northern Europe. In this study, EST derived simple sequence repeat (SSR) markers were developed for the assessment of putative functional diversity in Austrian Norway spruce stands.

Results

SSR sequences were identified by analyzing 14,022 publicly available EST sequences. Tri-nucleotide repeat motifs were most abundant in the data set followed by penta- and hexa-nucleotide repeats. Specific primer pairs were designed for sixty loci. Among these, 27 displayed polymorphism in a testing population of 16 P. abies individuals sampled across Austria and in an additional screening population of 96 P. abies individuals from two geographically distinct Austrian populations. Allele numbers per locus ranged from two to 17 with observed heterozygosity ranging from 0.075 to 0.99.

Conclusions

We have characterized variable EST SSR markers for Norway spruce detected in expressed genes. Due to their moderate to high degree of variability in the two tested screening populations, these newly developed SSR markers are well suited for the analysis of stress related functional variation present in Norway spruce populations.

Background

Natural populations of Picea abies L. (Norway spruce) are found from north-western Europe outside permafrost areas down to northern Greece, westwards to the Massif Central (France) and east to the Ural Mountains. Picea abies is growing above 400-500 m and ascends close to 2000 m in the Alps. Studies on genetic variation based on allozymes have shown that Picea abies genetic differentiation among populations is rather low over its whole distribution range [1, 2]. Previous studies on the genetic structure of P. abies using organelle markers showed pronounced differentiation between north-east boreal origins and areas in the central European mountains [3, 4], supporting the hypothesis of two distinct main glacial refugia as postulated from pollen data [5].

Initial reports on the occurrence of SSRs in conifers such as Pinus radiata[6], Pinus sylvestris[7] or Picea abies[8] have shown that marker development for such complex genomes is difficult. Frequently several DNA fragments in addition to the expected ones are amplified when using primers flanking putative SSR regions. This can be attributed to the very large size of the conifer genomes, with Norway spruce having 39.140 Mb in the diploid genome (2n = 24) as well as the high proportion of repetitive DNA in the conifer genomes [9]. These repetitive elements as well as pseudogenes frequently produce complex amplification products from multiple loci [10, 11]. To overcome this problem, Scotti et al. [12] showed that by isolating di-nucleotide SSRs from cDNA libraries of conifer species this problem can be overcome relying on the fact that expressed genes are less likely to be of repetitive nature in the genome.

Following this line of exploiting the advantages of publicly available data on expressed sequences (ESTs) as source for marker development [13] as described also by Rungis et al. [14] for conifers, we used Norway spruce EST sequences from NCBI for in silico identification of SSR regions which could serve for marker development.

Results

Screening of 14,022 Norway Spruce EST sequences from the NCBI dbEST revealed 158 sequences containing various repeat motifs. Clustering of these sequences produced 92 SSR containing 'unigenes' which fell into 36 clusters and 56 singletons. In these 92 unigenes, 48 different repeat motifs were identified, with tri-nucleotide (50%), in particular (CGG)n and CAA)n, repeats being the most abundant, followed by penta- (23%) and hexanucleotide repeats (10.4%) respectively. Di- and tetranucleotide repeats were the least abundant with 8.3% each. Twenty-seven out of 60 planned primer pairs amplified polymorphic products in the testing population of 16 individuals, while two did not generate a fragment and 31 proved to be monomorphic [see Additional file 1]. Four of the 27 polymorphic SSR regions showing more than 2 alleles per locus (Pa_16, Pa_24, Pa_34 and Pa_40) in the testing population were excluded from further analysis. In a total of 96 individuals 135 alleles were detected in the 23 remaining loci (Table 1) ranging from 2 to 17 alleles per locus (Table 2) with a mean value of 5.6. Total number of effective alleles was and 50.645 with a minimum of 1.123, a maximum of 4.115 and a mean value of 2.202. 87% of the variable regions were based on trinucleotide repeats, the rest were pentanucleotide repeats. Di-, tetra and hexanucleotide repeats proofed to be not polymorphic. Loci Pa_41 and Pa_53 were not polymorphic in the Mayrhofen population. Values for expected heterozygosity ranged from 0.021 to 0.780 in the Gusswerk population (mean 0.367) and from 0.123 to 0.769 in the Mayrhofen population (mean 0.385). Observed heterozygosity was found to be between 0.021 and 1.000 in the Gusswerk population (mean 0.461) and between 0.042 and 1.000 in the Mayrhofen population (mean 0.515). Differences in observed heterozygosities between the two populations ranged from zero (Pa_44) to 0.894 (Pa_49). The minimum difference of expected heterozygosities between the two populations was found at locus Pa_12 (0.002) and the maximum at locus Pa_49 (0.382). Regarding the Gusswerk population, in eleven loci the observed heterozygosity was significantly higher and in three loci significantly lower than the expected value. In the Mayrhofen population we found thirteen loci with the observed heterozygosity significantly higher than the expected and in four loci it was significantly lower. Eleven loci showed significant departure from Hardy-Weinberg expectations (HWE, Guo and Thompson's exact test [P < 0.05]) within the 48 investigated individuals from the Gusswerk population. The number of loci with significant departure from HWE was higher in the Mayerhofen population (16 loci). Frequency of null alleles was variable from zero to 99.0% in the Gusswerk population and from zero to 85.4% in the Mayerhofen population. In both populations, null alleles were present with a high frequency (above 5%) in more than half of the loci deviating from HWE. Tests for linkage disequilibrium (P < 0.01) revealed no disequilibrium among pair wise compared loci. Fst ranged between 0 and 0.288 with a mean value of 0.033 (after application of the ENA correction described in Chapuis and Estoup (2007), Table 3). Repeat numbers of all polymorphic di- and pentanucleotide repeats added up to a multiple of three and therefore did not cause a frameshift. All polymorphic SSRs are lying within open reading frame sequences (ORF) as detected by GetORF [15]. Fourteen sequences hit functionally annotated genes when compared to the NCBI nucleotide database [see Additional file 2]. The test for outlier loci revealed that Pa_51 (P = 1.000) and Pa_42 (P = 0.981) are under positive selection while the other loci are supposed to behave neutral (P < 0.95).
Table 1

Characteristics of polymorphic SSR loci isolated from Picea abies L

Locus name

GeneBank Accession

Repeat type

Primer Sequence (5' - 3')

Size range (bp)

Ta (°C)

Pa_5

GT887224

(CCG)n

F: AGGTGGATATGTTCATCAAC

136-158

53

   

R: CGCATACTCATCCCTAAC

  

Pa_12

AM170164

(AAG)n

F: GACCGAGAACCCTTGTT

136-138

53

   

R: CAAAAGCAGGAAAGAAGAAC

  

Pa_22

GT886979

(TTC)n

F: TCACTGGCCACAGTTTATCG

169-188

55

   

R: ATGAGGCCCAAGAGGAAGAC

  

Pa_25

GT887533

(CTG)n

F: TGATTGAAATGATGGCTGCT

131-165

55

   

R: CATGTACGGTGCTCCTCCTC

  

Pa_28

GT887962

(TCG)n

F: GGCCGAAAGTGCTACTGCTA

148-162

62

   

R: TGCTCCAGAAGAACACTCACA

  

Pa_29

GT884785

(CAA)n

F: ACAACAGCAACAGCAGCAAC

97-108

62

   

R: CGGGCTGAAGAATTTGTTGT

  

Pa_33

GT884592

(CGG)n

F: GGTCGAGGAGGAGGAGGTAG

91-104

62

   

R: CACCGCTAGTGCAGTCTCTG

  

Pa_36

GT887107

(CGG)n

F: CGGCAGGAACATCACTGTTA

178-200

62

   

R: ACCGTAACCTCCCCTACCAC

  

Pa_41

AM169657

(CTG)n

F: CGAAGAAGAAAGCGAGGATG

176-183

62

   

R: CAGGCTGCGAGAATCCTCTA

  

Pa_42

AM169827

(CCG)n

F: CAATGCAATGGCCTCCTATC

160-163

62

   

R: TAGACAGCAGCACGTCTCGT

  

Pa_43

AM169948

(GAA)n

F: AACCAGCCGGAGTCTGTAAA

168-175

62

   

R: TGCTTCTGTCTGACCAGGTG

  

Pa_44

AM171132

(GGA)n

F: AAGGCAGCCAAAGTGAAGAA

274-293

62

   

R: CTTGGCATTCCCTAGTGAGC

  

Pa_47

AM172144

(CAG)n

F: ATCAATTGCCCTACCAGCAC

106-118

62

   

R: TGCTCAATTTCCTGCATCTG

  

Pa_48

AM172164

(CGG)n

F: ATTGCACAAGAGCGAACCTT

131-195

62

   

R: CCAGCACCAAAATCACCAG

  

Pa_49

AM173566

(ATG)n

F: GAAAGGCGAAAGCAAAACTG

117,128

62

   

R: CCGTGTTTTTGAGGGAAGAA

  

Pa_50

AM174647

(CAG)n

F: CCTCTCAGCCAAATGCAAAT

124-129

62

   

R: GTCTCCGCAGAGCCATTACT

  

Pa_51

AM175215

(CCA)n

F: CAGATGTGGGCACTTGTTTG

119-140

62

   

R: TGGTCATGGTGGTGTTCAT

  

Pa_52

AM175251

(CCA)n

F: GTAGTGTCACCGGCTCCTTT

135-145

62

   

R: CTGGAGGATGATGGTGGTG

  

Pa_53

ES290836

(TCG)n

F: CCCAATGAAGATCTCGATGC

176-178

62

   

R: GGCTTTGCAGGAAACAAGAA

  

Pa_55

GT887161

(GAA)n

F: TGAGCAACCAGAAAATCACG

148-158

62

   

R: TCTCAACCCCTTTGTTTTCG

  

Pa_56

GT884695

(AGGTG)n

F: ATCGTCTGCATTGCATTCAC

113-128

62

   

R: CTTCGTTCCTTCCTGATCCA

  

Pa_59

AM169794

(CTCTG)n

F: TAGACCACGTTGTGCTGAAA

90-112

62

   

R: GCGACCTTTCGCAATTAAAC

  

Pa_60

GT885001

(GGCTG)n

F: CGCCGTATCCATTCCCAAGC

241-264

62

   

R: CCCAGCCCAGTTCAGTTTGC

  

Ta, annealing temperature

Table 2

Number of observed and effective alleles, observed and expected heterozygosity estimates for 23 polymorphic SSR markers with two Picea abies L. populations

Locus name

Na

Ne

Gusswerk

Mayrhofen

   

Ho

He

Ho

He

Pa_5

7

1.805

0.432

0.347

0.791

0.533

Pa_12

2

1.999

1.000

0.507

0.956

0.505

Pa_22

6

2.016

0.511

0.439

0.892

0.556

Pa_25

8

1.318

0.109

0.185

0.042

0.295

Pa_28

8

4.049

0.681

0.780

0.542

0.428

Pa_29

5

1.792

0.447

0.351

0.688

0.522

Pa_33

9

2.572

0.957

0.637

0.979

0.584

Pa_36

5

1.175

0.149

0.141

0.167

0.159

Pa_41

5

1.286

0.261

0.412

n.p.

n.p.

Pa_42

4

2.311

0.021

0.021

0.255

0.256

Pa_43

6

2.559

0.174

0.162

0.234

0.280

Pa_44

7

1.357

0.188

0.232

0.188

0.299

Pa_47

4

2.052

0.500

0.407

0.979

0.535

Pa_48

17

4.115

0.766

0.779

0.660

0.748

Pa_49

5

2.917

0.979

0.505

0.085

0.123

Pa_50

4

1.959

0.289

0.293

1.000

0.505

Pa_51

3

2.012

0.042

0.041

0.167

0.154

Pa_52

5

2.914

0.917

0.546

0.688

0.470

Pa_53

2

2.000

0.021

0.021

n.p.

n.p.

Pa_55

3

2.009

0.958

0.514

0.896

0.500

Pa_56

6

3.508

0.625

0.655

0.854

0.769

Pa_59

3

1.123

0.042

0.041

0.146

0.175

Pa_60

5

1.799

0.542

0.423

0.646

0.469

Mean

5.6

2.202

0.461

0.367

0.515

0.385

Total

129

50.645

    

Na number of observed alleles, Ne, effective number of alleles, Ho observed heterozygosity, He expected heterozygosity, n.p. not polymorphic

Table 3

Estimation of uncorrected and corrected FST, frequency of null alleles and deviation from Hardy-Weinberg equilibrium

Locus name

Fst

Fst (ENA)

Gusswerk

Mayrhofen

   

Fn

HWE p-value

Fn

HWE p-value

Pa_5

0.046

0.046

0.000

0.340

0.000

0.001*

Pa_12

0.000

0.000

0.000

0.000*

0.000

0.000*

Pa_22

0.065

0.065

0.167

0.038*

0.006

0.000*

Pa_25

0.007

0.031

0.127

0.004*

0.244

0.000*

Pa_28

0.004

0.003

0.191

0.000*

0.274

0.003*

Pa_29

0.035

0.036

0.000

0.088

0.008

0.001*

Pa_33

0.020

0.020

0.000

0.000*

0.000

0.000*

Pa_36

0.000

0.000

0.000

1.000

0.000

1.000

Pa_41

0.007

0.041

0.293

0.000*

0.146

1.000

Pa_42

0.107

0.144

0.990

n.a.

0.854

0.023*

Pa_43

0.000

0.000

0.000

1.000

0.100

0.013*

Pa_44

0.000

0.000

0.060

0.009*

0.120

0.000*

Pa_47

0.000

0.000

0.000

0.212

0.000

0.097

Pa_48

0.000

0.000

0.046

0.074

0.047

0.256

Pa_49

0.000

0.000

0.000

0.000*

0.000

0.000*

Pa_50

0.011

0.023

0.087

0.116

0.000

1.000

Pa_51

0.288

0.288

0.979

1.000

0.571

0.000*

Pa_52

0.006

0.006

0.000

0.000*

0.000

0.000*

Pa_53

0.000

0.000

0.990

n.a.

n.a.

n.a.

Pa_55

0.000

0.000

0.227

0.000*

0.323

0.000*

Pa_56

0.019

0.018

0.281

0.003*

0.141

0.001*

Pa_59

0.036

0.057

0.000

1.000

0.056

0.342

Pa_60

0.006

0.006

0.694

0.202

0.597

0.005*

Mean

0.027

0.033

    

FST, fixation index (Weir, 1996), FST(ENA), fixation index without null alleles (ENA), Fn, frequency of null alleles, HWE p-value, test for deviation from Hardy-Weinberg equilibrium, *, significant deviation from Hardy-Weinberg equilibrium (P < 0.05), n.a., not analyzed

Discussion

Several studies describe the development of SSR markers for Norway spruce [8, 12]. In the present work we used EST mining of sequences available in databases instead of classical approaches like screening of genomic libraries or fragment enrichment and subsequent cloning. The newly developed markers can be used to complete unsaturated maps, and might be useful in marker assisted breeding and population genetics.

The high number of loci deviating from Hardy-Weinberg equilibrium could partly be explained by the presence of null alleles (Table 3), partly be a result of sampling or selective pressure on the coding regions which is supported by the fact that loci deviating from HWE are not consistent between the two populations. Null alleles can occur due to mutations in primer binding sites and lead to the overestimation of homozygosity as shown by Callen [16]. The presence of such null alleles as estimated in this study may further be confirmed by synthesis of alternative oligonucleotide primer pairs. Increased appearance of homozygotes in some loci supports the hypothesis of selective pressure which might be caused by advantages of recessive or dominant homozygotes known as directional selection. Positive selection was confirmed by outlier detection for two loci which show a high frequency of homozygotes. Both of them are located in coding regions - Pa_42 shows homology to a cysteine protease and Pa_51 is related to a cadmium transporting ATPase. These genes play important roles in various physiological processes, including response to biotic and abiotic stress [17, 18]. Therefore, additional data of both populations (e.g. environmental growth) conditions would be of interest. Especially locus Pa_51 may be an interesting target for diversity studies because departure from HWE was only detected in the Mayrhofen population. But although these two loci show considerable degrees of population differentiation, the low Fst values present in the other loci support previous findings [3, 4] that there is no major degree of differentiation among Alpine Norway spruce populations.

The new SSR markers characterized in this study are a good resource for assessing diversity in Alpine spruce populations and might be of further use for applications in forestry. Additionally, 31 monomorphic SSR loci were identified in this study. It is still possible to derive polymorphic data from them when screening Norway spruce populations from different origin, as it has already been shown that flanking regions of monomorphic SSRs show a moderate to high degree of variability [19]. Possible variation within these flanking regions in Norway spruce could serve as alternative source for diversity studies applying different techniques for the identification of variability within these regions.

All variable SSRs are located within ORF sequences and 60% of them gave significant hits to functional genes present in GenBank. A frameshift caused by length variation within an ORF might lead to distortion in the coding region and thus to the abortion of the coded protein. In all of the newly identified EST-SSRs no frameshift is occurring because either, as in 50% of the cases, the SSRs are trinucleotide repeats or the repeat number of polymorphic di- and pentanucleotide repeats alters in such a way that the sum of the basepair variation is a multiple of three.

Conclusions

We have identified 92 new SSR regions with 48 different repeat motifs in the expressed part of the Norway spruce genome. In two screening populations of 48 individuals each, 23 SSR regions showed a moderate to high degree of polymorphism. Although a high number of SSR markers were already developed for Norway spruce, most of the available SSRs consist of dinucleotide repeats and do not include our tri- and pentanucleotide repeats. We have demonstrated that on the one hand genetic differentiation between distinct stands is low but on the other hand selective forces are likely to have been acting on several genes because deviations from HWE could not only be explained due to null alleles and test for outliers revealed two loci under positive selection. The results gave an insight into the abundant repeat classes and will be of use in analysis of variation linked to expressed genes in Alpine Norway spruce populations as well as evolutionary forces acting at these loci.

Methods

14,022 Norway Spruce EST sequences were extracted from the NCBI dbEST and screened for SSR sequences with the SciRoKo software program [20]. Only perfect SSRs were searched in two iterations, one for mono- and dinucleotides (at least 4 repeats), and another one for tri-, tetra-, penta- and hexanucleotides (at least 3 repeats). SSR motif containing sequences were subjected to clustering and annotation using the EST2uni pipeline [21]. For clustering, the default settings (30 bp minimum overlap with at least 94% identity for pairwise alignment using BLAST, 93% overlap identity cutoff for assembly using CAP3) were applied. The resulting Unigene Set (contigs and singletons) was compared against three protein databases with BLASTX, in particular NCBI NR, Arabidopsis TAIR7, and Uniprot/Swissprot, using an e-value of 1e-10 as cutoff. The descriptions of the BLAST hits obtained with the different BLAST runs were parsed and merged to yield a descriptive annotation for each unigene. The annotations were attributed with modifiers like "Similar to" or "Highly similar to", depending on the e-value of the alignment with the corresponding BLAST hit.

Plant material used: 16 samples from all over Austria (testing population) and two times 48 individuals from two distinct populations (Gusswerk, Styria [N 47° 44|, E 15° 18|]; Mayrhofen, Tyrol [N 47° 11', E 11° 52']; screening population). DNA was kindly provided by the Federal Research and Training Centre for Forests, Natural Hazards and Landscape (BFW).

60 primer pairs were designed using Primer3 web interface [22] with default settings. PCR reactions were performed in 25 μl volumes containing 50 ng genomic DNA, 1X PCR Buffer (QIAGEN), 1 mM MgCl2, 0.2 mM each dNTP, 0.3 μM FAM-labelled forward primer, 0.3 μM reverse primer and 0.625 U HotStar Taq polymerase (QIAGEN). The PCR thermal profile consisted of 15 min. initial denaturation at 95 °C followed by 35 cycles denaturation at 95 °C for 50 sec., a primer-specific annealing-temperature (Table 1) for 50 sec., extension at 72 °C for 105 sec., and a final extension at 72 °C for 10 minutes. Fragments amplified in 16 individuals from all over Austria (testing population) and 96 individuals from 2 distinct locations in Austria (screening population) were analyzed on an ABI 3100 Genetic Analyzer. Fragment sizes were extracted using PeakScanner 1.0 (Applied Biosystems, Foster City, California, USA) and allele calls were manually performed in Excel. The testing population was only used to test for polymorphic loci and was not included in further calculations. Number of alleles, effective number of alleles, observed and expected heterozygosities and deviation from Hardy-Weinberg equilibrium were calculated using Genepop 4.0 [23]. Fixation indices and fixation indices excluding null alleles (ENA), as well as estimates of null alleles were calculated with FreeNA [24] and SSR presence in coding regions was analyzed with the GetORF software using default settings. Test for outlier loci were performed with LOSITAN [25] using an infinite allele model with 100.000 simulations, a confidence interval of 0.95 and a subsample size of 75.

Declarations

Acknowledgements

The work was supported by the Austrian Federal Ministry of Agriculture, Forestry, Environment and Water Management and conducted in a cooperation project with the Federal Research and Training Centre for Forests, Natural Hazards and Landscape, Vienna, Austria.

Authors’ Affiliations

(1)
AIT Austrian Institute of Technology GmbH, Health & Environment Department,
(2)
Istituto di Genetica Vegetale, CNR

References

  1. Lagercrantz U, Ryman N: Genetic structure of Norway spruce (Picea abies): concordance of morphological and allozymic variation. Evolution. 1990, 44: 38-53. 10.2307/2409523.View ArticleGoogle Scholar
  2. Bergmann F, Ruetz W: Isozyme genetic variation and heterozygosity in random tree samples and selected orchard clones from the same Norway spruce populations. For Ecol Manage. 1991, 46 (1-2): 39-48. 10.1016/0378-1127(91)90243-O.View ArticleGoogle Scholar
  3. Vendramin GG, Anzidei M, Madaghiele A, Sperisen C, Bucci G: Chloroplast microsatellite analysis reveals the presence of population subdivision in Norway spruce (Picea abies K.). Genome. 2000, 43 (1): 68-78.PubMedView ArticleGoogle Scholar
  4. Sperisen C, Büchler U, Gugerli F, Mátyás G, Geburek T, Vendramin GG: Tandem repeats in plant mitochondrial genomes: application to the analysis of population differentiation in the conifer Norway spruce. Mol Ecol. 2001, 10 (1): 257-263. 10.1046/j.1365-294X.2001.01180.x.PubMedView ArticleGoogle Scholar
  5. Huntley B, Birks HJB: An Atlas of Past and Present Pollen Maps for Europe: 0-13000 years ago. 1983, Cambridge: Cambridge University PressGoogle Scholar
  6. Smith DN, Devey ME: Occurrence and inheritance of microsatellites in Pinus radiata. Genome. 1994, 37: 977-983. 10.1139/g94-138.PubMedView ArticleGoogle Scholar
  7. Kostia S, Varvio SL, Vakkari P, Pulkkinen P: Microsatellite sequences in a conifer, Pinus sylvestris. Genome. 1995, 38: 1244-1248. 10.1139/g95-163.PubMedView ArticleGoogle Scholar
  8. Pfeiffer A, Olivieri AM, Morgante M: Identification and characterization of microsatellites in Norway spruce (Picea abies K.). Genome. 1994, 40 (4): 411-419.View ArticleGoogle Scholar
  9. Murray BG, Leitch IJ, Bennet MD: Gymnosperm DNA C-values database (release 4.0, Dec. 2010). 2010, [http://www.kew.org/cvalues/]Google Scholar
  10. Echt CS, May-Marquardt P, Hseih M, Zahorchak R: Characterization of microsatellite markers in eastern white pine. Genome. 1996, 39: 1102-1108. 10.1139/g96-138.PubMedView ArticleGoogle Scholar
  11. Soranzo N, Provan J, Powell W: Characterisation of microsatellite loci in Pinus sylvestris L. Mol Ecol. 1998, 7: 1260-1261.PubMedGoogle Scholar
  12. Scotti I, Magni F, Fink R, Powell W, Binelli G, Hedley PE: Microsatellite repeats are not randomly distributed within Norway spruce (Picea abies K.) expressed sequences. Genome. 2000, 43: 41-46.PubMedView ArticleGoogle Scholar
  13. Varshney RK, Thiel T, Stein N, Langridge P, Graner A: In silico analysis on frequency and distribution of microsatellites in ESTs of some cereal species. Cell Mol Biol Lett. 2002, 7: 537-546.PubMedGoogle Scholar
  14. Rungis SD, Bérubé Y, Zhang J, Ralph S, Ritland CE, Ellis BE, Douglas C: Robust simple sequence markers for spruce (Picea spp.) from expressed sequence tags. Theor Appl Gen. 2004, 109: 1283-1294. 10.1007/s00122-004-1742-5.View ArticleGoogle Scholar
  15. GetORF. [http://embossgui.sourceforge.net/demo/getorf.html]
  16. Callen DF, Thompson AD, Shen Y, Pillips HA, Richards RI, Mulley JC, Sutherland GR: Incidence and Origin of "Null" Alleles in the (AC)n Microsatellite Markers. Am J Hum Genet. 1993, 52: 922-927.PubMedPubMed CentralGoogle Scholar
  17. Solomon M, Belenghi B, Delledonne M, Menachem E, Levine A: The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell. 1999, 11: 431-444.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Courbot M, Willems G, Motte P, Arvidsson S, Roosens N, Saumitou-Laprade P, Verbruggen N: A major quantitative trait locus for cadmium tolerance in Arabidopsis halleri colocalizes with HMA4, a gene encoding a heavy metal ATPase. Plant Physiol. 2007, 144: 1052-106. 10.1104/pp.106.095133.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Chatrou LW, Escribano MB, Viruel MA, Maas JW, Richardson JE, Hormaza JI: Flanking regions of monomorphic microsatellite loci provide a new source of data for plant species-level phylogenetics. Mol Phylogenet Evol. 2009, 53: 726-733. 10.1016/j.ympev.2009.07.024.PubMedView ArticleGoogle Scholar
  20. Kofler RC, Schlötterer C, Lelley T: SciRoKo: A new tool for whole genome microsatellite search and investigation (version 3.4). [http://kofler.or.at/bioinformatics/SciRoKo/index.html]
  21. Forment J, Gilabert F, Robles A, Conjero V, Nuez F, Blanca JM: EST2uni: an open, parallel tool for automated EST analysis and database creation, with a data mining web interface and microarray expression data integration. [http://cichlid.umd.edu/est2uni/]
  22. Rozen S, Skaletsky HJ: Primer3 on the WWW for general users and for biologist programmers (version 0.0.4). [http://frodo.wi.mit.edu/primer3/]
  23. Raymond M, Rousset F: GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered. 1995, 86: 248-249.Google Scholar
  24. Chapuis M-P, Estoup A: Microsatellite null alleles and estimation of population differentiation. Mol Biol Evol. 2007, 24: 621-631.PubMedView ArticleGoogle Scholar
  25. Beaumont MA, Nichols RA: Evaluating loci for use in the genetic analysis of population structure. P Roy Soc Lond B Bio. 1996, 263: 1619-1626. 10.1098/rspb.1996.0237.View ArticleGoogle Scholar

Copyright

© Fluch et al; licensee BioMed Central Ltd. 2011

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement