Figure 1

a. Genomic organization of the mouse vitamin K epoxide reductase complex subunit 1 gene ( Vkorc1 ) and sequencing strategy. Exons are depicted in black and the untranslated regions (3'- and 5'-UTR) are shaded in gray. +1 indicates the transcription start. The primer pairs used to amplify segments 1–4 were (5' to 3') -1056seg1F CAC GAC GTT GTA AAA CGA C GG TCT GGG AAA TCA CAG GAA, -109seg1R GGA TAA CAA TTT CAC ACA GG C TAG GAA TGC TGG CGT GGT A, -205seg2F CAC GAC GTT GTA AAA CGA C TG CAG CCT CTC CAA CTA CAA T, 688seg2R GGA TAA CAA TTT CAC ACA GG A TGT GCC ACC TCA CAA ACA A, 726seg3F CAC GAC GTT GTA AAA CGA C CG TTC GGG AGT TGA GTC TCT, 1712seg3R GGA TAA CAA TTT CAC ACA GG A CCT ACC AGG TGT GGT CCA A, 1671seg4F CAC GAC GTT GTA AAA CGA C GT GCT GGG ATT AAA GCA TGG, 2614seg4R GGA TAA CAA TTT CAC ACA GG G AAA GAC TGA CAC CCC GAA G. The M13 primer tail used for sequencing is shown in bold face type. F and R refer to forward primer and reverse primer, respectively. b. Overview of polymorphisms in the coding and 5' region of theVkorc1. For each polymorphism the location in the mouse reference sequence (Ensembl No. ENSMUSG00000030804) and whether these are synonymous or non-synonymous is indicated. Strains (represented by a three-letter code) representative for haplotypes 1–10 are shown. I-IV refer to the clades identified by phylogenetic analysis of Vkorc1 haplotypes (c.f. Figure 2b). Nucleotides different from those in the reference sequence are shaded in gray. -indicate insertions/deletions (indels) and blank spaces indicate ambiguous or missing sequence. Five multiple-base indels are replaced by X (CTGTAAAGCTACTATTAACAGGACGGTA), L (ACACA), O(ATTGGGT), P (CAGCCCC), and Q (AGA).