Skip to main content

Table 4 PCR primers, forward (F) and reverse (R) listed 5' to 3', PCR product size in base pairs, and base pair position within the PCR product for the 13 SNPs concordant with the polled trait in Holsteins.

From: Single nucleotide polymorphisms concordant with the horned/polled trait in Holsteins

SNP Name Primer Set PCR Size Position
bC2163_AG_454 F: CTTGCCCTTGACTTTCTCTC 501 454
  R: CTCTCCTCCTCCTCAGTTTG   
bC2163_GA_333 F: GATTCACCACCACACTGGA 740 333
  R: CACCATCACAAAGCAGAAAA   
bC2163_GA_252 F: GGCAATGTCACCATCAACC 383 252
  R: CAAAGAACAGAAAGCCAACAAG   
bC2163_AC_126 F: TCTAAGTGCCTGTAATCTGTGAG 563 126
  R: AGGTCTTTTGCGGTGTAATC   
bC2163_CT_145 F: TCTAAGTGCCTGTAATCTGTGAG 563 145
  R: AGGTCTTTTGCGGTGTAATC   
bCLCVS1_TC_238 F: CTAAGGAATTTGACTCTCACCTCT 567 238
  R: CTACTCCCCTTCTGCTACCC   
bCLF1O1_GA_193 F: CTGGTCGGTTTGAGGGTTG 559 193
  R: AGCAGGAACTGGCTCTCGT   
bC2159_C-193T F: CTGGTCGGTTTGAGGGTTG 559 320
  R: AGCAGGAACTGGCTCTCGT   
bC2159_T372C F: TACTTTCTCTCATCTCACTTCCTC 370 165
  R: GTTTGTTTCCTTTGCCTCTG   
bSYNJ1_CT_271 F: TCACTGGATGTATGTCTGTTGG 461 271
  R: TCAGGAAGAGTAAATGGGTTTC   
bSYNJ1_CT_131 F: TCAGTATTTGTGGCATGTGG 508 131
  R: CTCGACTTGGTCTCACTGG   
bSYNJ1_AG_244 F: GAATGACAAAGAGGCAGAGG 497 244
  R: AGAGCTGGCCCTAAAGAAAG   
bSYNJ1_C3981T F: AACCACCAGAGTAACAGACTACAC 471 190
  R: CTGTCGGTGAAAGGATTTG