Skip to main content

Advertisement

Archived Comments for: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

Back to article

  1. Wrong accession number for EF1A

    Pal A. Olsvik, NIFES

    8 March 2013

    Due to a copy-paste error, the wrong accession number and primer sequences were provided for the EF1A assay in Table 2.

    The correct GenBank accession number is: EX722124
    Forward primer: CGGTATCCTCAAGCCCAACA
    Reverse primer: GTCAGAGACTCGTGGTGCATCT

    Competing interests

    No

Advertisement