Skip to main content

Advertisement

Table 2 qRT-PCR assays used to evaluate potential reference genes in Atlantic cod. Gene short names, Genbank accession numbers, PCR primer sequences, amplicon sizes and PCR efficiencies (mean ± STDEV in six tissues) are shown.

From: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

Gene Accession no. Forward primer (5' – 3') Reverse primer (5' – 3') Amplicon size (bp) PCR eff.
ACTB EX739174 CACAGCCGAGCGTGAGATT ACGAGCTAGAAGCGGTTTGC 95 2.03 ± 0.09
ARP-2 EX741634 TCTGCTCCGTGTGGAAGTTG CGAGAAGATCCTCTGCCACAA 131 2.06 ± 0.04
EF1A EX721840 CCCTGTGGAAGTGGCTGAAG CATCCAAGGGTCCGTATCTCTT 93 2.02 ± 0.11
Ubi EX735613 GGCCGCAAAGATGCAGAT CTGGGCTCGACCTCAAGAGT 69 1.91 ± 0.09
GAPDH EX725566 CCATGACAACTTTGGCATCGT AGGGTCCGTCCACTGTCTTCT 83 2.16 ± 0.07
RPS9 EX726043 TCTTTGAAGGTAATGCTCTGTTGAGA CGAGGATGTAATCCAACTTCATCTT 84 1.94 ± 0.08
ARP EX741373 TGATCCTCCACGACGATGAG CAGGGCCTTGGCGAAGA 113 1.95 ± 0.10
RPL4 EX725958 GGTGCCATACAGCTGATCCA CCAGGCATCACACTGCAGAA 123 1.98 ± 0.12
RPL22 EX727868 GTTACCGGTCTTCCCGTTGA AGAAGTCCAAAAAAGGAGCTTCCT 132 1.79 ± 0.08
RPL37 EX738140 CCGAGAAGCGCAAGAGAAAG GGTGGTACCTTCCCGGAATC 134 1.87 ± 0.06