Skip to main content

Table 1 Primer sequences, annealing temperature and amplicon information for the MS-HRM assays.

From: No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

Gene Primer Sequences
5' - 3'
Annealing temperature (°C) Amplified region (GenBank accession and nucleotide numbers) Screened CpGs/amplicon size (bp)
SDHA F - CGGGGTTTTAAAAATGTTGGTGTT 61 AC021087.5: 218153-218484 39/332
  R - CGAACCCCCGACATATCTACTATTACC    
SDHB 1 F - CGGGGGAAGTTAAATGGGTATG 60 AL049569.13: 17380588-17380744 14/157
  R - CGCCCAACCTACATCCACTAAA    
SDHB 2 F - GCGGTTAGTGGGTTTTTAGTGGAT 65 AL049569.13: 17380446-17380623 16/178
  R - CAAACAAACTCCGCCAAAAATTATAACC    
SDHC F - TCGTTATATGATATTTTTAATTTCGATTTTTAGT 56 AL592295.25: 161284096-161284197 8/102
  R - ATCTTAAATTCCGATCTAAACGAAAATAAC    
SDHD F - CGGGTTGGTGGATGATTTTGAG 62 AP002007.4: 111957596-111957689 4/94
  R - CCTCACCTCGACCTCCTAAAACAC    
FH F - TTTGTTTTATTTGTCGGTGTGAGGT 60 AL591898.1: 241683032-241683154 7/123
  R - AAAACTTAAATAAAATTTCTAAACGACTATAACCAC