Skip to main content

Table 1 SNaPshot probes for the detection of PIK3CA mutations.

From: A SNaPshot assay for the rapid and simple detection of four common hotspot codon mutations in the PIK3CA gene

Probe Sequence (5'->3') Size (bp) Mutation Concentration
in probe mix (μM)
E542K T(19)TACACGAGATCCTCTCTCT 38 G->A 0.8
E545G T(29)TCCTCTCTCTGAAATCACTG 49 A->G 2.3
E545K T(34)ATCCTCTCTCTGAAATCACT 54 G->A 1.5
H1047R T(46)TGAAACAAATGAATGATGCAC 67 A->G 1.5