Skip to main content

Table 1 List of primers used in the present study

From: The RAD51 and DMC1 homoeologous genes of bread wheat: cloning, molecular characterization and expression analysis

Primer name Primer sequence (5'-3') Tm°C Size (bp) Use
OsRAD51 Exon 1-2-F CCTCACATCCCGAGCATCTC 60 171 Cloning of full-length cDNA of wheat RAD51
OsRAD51 Exon 1-2-R TCACATCAACTGCAGCTATTCCAG    
OsRAD51 Exon 8-9-F GGTAGTGGCCCAAGTGGATG 60 564  
OsRAD51 Exon 8-9-R TGGTGGTCCAATATCACATAGGAG    
OsRAD51 Exon 1-7-F ATGTCGTCGGCGGCGG 65 889  
OsRAD51 Exon 1-7-R CTCATCCGCTAATTTCTGAAGGC    
OsRAD51 Exon 2-9-F AAGTCGATAAGATAAT TGAAGCA 60 879  
OsRAD51 Exon 2-9-R CTGAAACCTTGCTTCAGCT    
NotI-(dT)18 AACTGGAAGAATTCGCGGCCGCAGGAA(T)18    Cloning of full-length cDNA of wheat DMC1
Not I(dT) anchor AACTGGAAGAATTCGCGG    
TaDMC1 -DGSP1 GAAGAGCCTTTCAGGCTTCTG 55 700  
TaDMC1- DGSP2 GGTGAACTTGCAGAGCGCCAG 55 772  
TaDMC1- DGSP3 CTGGCGCTCTGCAAGTTCACC 55 772  
TaDMC1- DGSP4 GGAAGACCCAGTTGGCTCAT 55 461  
TaDMC1- DGSP5 GGTGAACTTGCAGAGCGTCAG 55 207  
TaRAD51 Exon 8-F CCATGATGGTGGAGACAAGG 65 2500 Amplification of intronic regions in TaRAD51 &TaDMC1 genes
TaRAD51 3'UTR-R TGGTGGTCCAATATCACATAGGAG    
TaDMC1-5'UTR-F ATGATCCACATTCCACCCGC 65 2500  
TaDMC1-Exon 6-R ATGAGCCAACTGGGTCTTCC    
iTaRAD51-7A&7D-F CGGAAGGATTGGTA AAAAAT 55 450 & 500 TaRAD51 &TaDMC1 genome-specific primers based on intronic regions for localization on wheat genome
iTaRAD51-7A&7D-R CACTCAGAAATGACG AAAAAGG    
iTaRAD51-7B-F ATGGTGGAGACAA GGTGAG 63 500  
iTaRAD51-7B-R GTACACTAGCATTAC GGTACAG    
iTaDMC1-5A-F AGCCTCCGCCCCACTTCCTTC 63 500  
iTaDMC1-5A-R ACAAACGCAACACGA GCACACG    
iTaDMC1-5B-F AGCCTTGGCCCCACTTCCTC 63 500  
iTaDMC1-5B-R ACGCGCTGCACGCA CCAAA    
iTaDMC1-5D-F CTCCTCTGACGCAG GCGGA 63 389  
iTaDMC1-5D-R ACGCGCTGCACGC ACCAAA    
TaRAD51-UTR-F CCTCACATCCCGAGCATCTC 63 1528 TaRAD51 cDNA full-length primers including UTR's
TaRAD51-UTR-R CTCCTATGTGATATTGGACCACCA    
eTaRAD51-7A-F GGGGATACCTCGTGTATCAGACT 58 328 TaRAD51 genome-specific primers based on exons for QRT-PCR analyses
eTaRAD51-R TGGTGGTCCAATATCACATAGGAG    
eTaRAD51-7B-F GATACATCGTGTATCGGACA 58 328  
eTaRAD51- R TGGTGGTCCAATATCACATAGGAG    
eTaRAD51-7D-F TGGGGATACATCGTGTATTGGCCT 65 327  
eTaRAD51- R TGGTGGTCCAATATCACATAGGAG    
TaDMC1-UTR-F ATGATCCACATTCCACCCGC 63 1268 TaDMC1 cDNA full-length primers including UTR's
TaDMC1-UTR-R CACTGCAGAAAAGAAATTGGGCAAC    
eTaDMC1-5A-F AGCCTCCGCCCCACTTCCTTC 65 150 TaDMC1 genome-specific primers based on exons QRT-PCR analyses
eTaDMC1-R CTTGTCGATGGACTCGAAGCACTC    
eTaDMC1-5B-F AGCCTTGGCCCCACTTC CTC 65 150  
eTaDMC1-R CTTGTCGATGGACTCGAAGCACTC    
eTaDMC1-5D-F TTCTCCTCCAGCAGCACGCGAA 65 150  
eTaDMC1-R CTTGTCGATGGACTCGAAGCACTC    
TUB-F TCTTCATGGTGGGCTTCGC 55 475 QRT-PCR control primers
TUB-R CGCCTCGGGTGAACTCCATCT