Cloning and characterization of a novel alternatively spliced transcript of the human CHD7 putative helicase

BMC Research Notes

Table 1 Analysis of the sequences flanking the alternative splice sites of the CHD7 CRA_e alternative transcript

Alternative transcript	Donor splice site location (nt)^a	Acceptor splice site location (nt)^a	Intron size /kb	EXON/intron/EXON (consensus splice sequence)^b 5' CAG\|guragu...cu/gac/u(y)_{10 15}nyag\|G) 3'
CHD7 CRA_e	Exon 3 (47)	Exon 36 (112)	81	5' CAG\|gu uagu...c agau gugcuguuuuccuauuucag\|A 3'

a) Location of the exonics donor and acceptor splice sites of the CHD7 CRA_e alternative transcript. The numbers in parenthesis represent the exonic splicing sites at exons 3 and 36; b) The consensus sequence associated to splice donor, branch and acceptor sites according to Padgett [30] and Keller and Noon [31]. The vertical lines represent either 5' or 3' splice site and the putative branch point is underlined. The sequence of the investigated splice site in the CHD7 CRA_e transcript is represented below the consensus splice sequence. Nucleotides identity between the consensus and the investigated splice sites are shown in bold r = purine (A or G); y = pyrimidine (C or U)

ISSN: 1756-0500