Skip to main content

Table 4 Aberrations in the centromere region

From: Evidences showing wide presence of small genomic aberrations in chronic lymphocytic leukemia

Ditag Full-length (bp) CLL sample Chr. Location Sequence type
   1 2 3 4 5 6 7 8    
AAGCTTTCATTGGGATAACAGTGTTGAAGCTT 562 - + + - - + + + 2p11.1 132722630-132722850 ALR/Alpha
  893 - + - - - - + - 2p11.1 91677156-91682632 ALR/Alpha
  217 + + - + - - + - 2p11.1 91677835-91680254 ALR/Alpha
AAGCTTTCCAGTTAAGCTTTCTGGGGAAGCTT 1067 + + + + + + + - 2p11.1 91257036-91258039  
  1002 + - - - - - + - 2p11.1 91257036-91258039  
AAGCTTCTTTATGAGGAACAGTGTTGAAGCTT 216 + + + + - - + - 2p11.1 91670531-91670746 ALR/Alpha
  896 + + - + - - - - 2p11.1 91670531-91686712 ALR/Alpha
  901 + - - - - - + - 2p11.1 91670531-91686712 ALR/Alpha
  560 + - - - + - - - 2p11.1 91655191-91672448 ALR/Alpha
  2231 - - - - + + - - 2p11.1 91670550-91684334 ALR/Alpha
AAGCTTCTGAGAATGCCATCCCAATGAAGCTT 686 + - - - - - + - 2p11.1 91677155-91689898 ALR/Alpha
AAGCTTATTTGAGATGAAAGGAGTAGAAGCTT 1234 + + - - - - - - 2p11.1 91664565-91688410 ALR/Alpha
  726 + + + + + + + - 2p11.1 91676309-91680254 ALR/Alpha
AAGCTTCAACACTGTTGTTCCCAATGAAGCTT 612 - + + - - + - - 2p11.1 91676431-91689428 ALR/Alpha
AAGCTTCAATGGGATGAAGAGTGTTGAAGCTT 556 + + + - + + + - 2p11.1 91684461-91685014 ALR/Alpha
  894 - - + - - - + - 2p11.1 91677156-91680254 ALR/Alpha
AAGCTTCAATTGGGATAACAGTGTTGAAGCTT 555 - - - + - + + + 2p11.1 91677836-91680592 ALR/Alpha
AAGCTTCATTAGGGATAACAGTGTTGAAGCTT 555 + + - - - + - - 2p11.1 91677156-91677709 ALR/Alpha
AAGCTTCATTGGGAACAACAGTGTTGAAGCTT 269 - + - - - - + - 2p11.1 91677155-91677709 ALR/Alpha
AAGCTTCATTGGGATGGCATTCTCAGAAGCTT 685 + - - - - - - - 2p11.1 91674610-91684466 ALR/Alpha
AAGCTTCTATTGGGATAACAGTGTTGAAGCTT 556 + + + - - + + + 2p11.1 91672232-91680592 ALR/Alpha
  893 - + - - - - + + 2p11.1 91653836-91682632 ALR/Alpha
AAGCTTGACTCATTGCGTCTTATTCTAAGCTT 1179 - + + + + + + - 2p11.1 91031886-91033063 ERVL-B4-int
AAGCTTAAAACTCCTTTATGAAAAGAAAGCTT 637 + - - - - - - - 10q11.1 41848823-41861037 ALR/Alpha
AAGCTTAAACTCCGTGCATCAAAAGAAAGCTT 689 + + - - - - + - 10q11.1 41718813-41720661 ALR/Alpha
  1407 + - - - - - - - 10q11.1 41718474-41727608 ALR/Alpha
  601 + - - - - - - - 10q11.1 41718888-41720661 ALR/Alpha
AAGCTTAAACTTCTTGTATGAAAAGAAAGCTT 2067 - + + - - - + - 10q11.1 41847790-41864775 ALR/Alpha
  1023 + + - - - - - - 10q11.1 41718797-41729299 ALR/Alpha
  970 + - - - - - - - 10q11.1 41850170-41864775 ALR/Alpha
  346 + - - - - - + - 10q11.1 41718460-41719477 ALR/Alpha
AAGCTTCAACGCTGCGCTATTGAAGGAAGCTT 345 - + + - - - - - 10q11.1 41726415-41729786 ALR/Alpha
  860 + + + + + + + + 12p11.1 34724897-34729300 ALR/Alpha
AAGCTTCAACTCTGTCCGCCTAAAGGAAGCTT 175 - - - - + - + - 10q11.1 41719301-41720316 ALR/Alpha
AAGCTTCAACTCTGTGCATTGGCCTCAAGCTT 279 + + + + + + + + 10q11.1 41849321-41850275 ALR/Alpha
  622 + + + + - + + - 10q11.1 41849321-41858079 ALR/Alpha
  619 - + - - - + + - 10q11.1 41849321-41861137 ALR/Alpha
AAGCTTCAACTCTGTGCCGCTAAAGGAAGCTT 344 - + + - + + + + 10q11.1 41718623-41720492 ALR/Alpha
  2280 + - - - - + - - 10q11.1 41717944-41720994 ALR/Alpha
  1359 + - - - - - - - 10q11.1 41717944-41729975 ALR/Alpha
  1190 + - - - - - - - 10q11.1 41718623-41720492 ALR/Alpha
  681 + - - - - - - - 10q11.1 41720147-41729975 ALR/Alpha
AAGCTTCCTTCAGAAACAAGGAGTTTAAGCTT 858 + - + - + + + - 10q11.1 41718623-41720661 ALR/Alpha
AAGCTTCCTTTTAGGCCACAGAGTTGAAGCTT 348 - + + - - - - - 10q11.1 41719301-41720492 ALR/Alpha
  1029 - + + - - - - - 10q11.1 41847960-41861361 ALR/Alpha
  684 + - - - - - + - 10q11.1 41718622-41721845 ALR/Alpha
AAGCTTCCTTTTCATACAAGGAGTTTAAGCTT 1498 - + - - - + - - 10q11.1 41718461-41720661 ALR/Alpha
AAGCTTCTTTTTCATGCAAGGAGTTTAAGCTT 385 + - - - + + + - 10q11.1 41718767-41719477 ALR/Alpha
  724 + - - - - - - - 10q11.1 41718767-41720661 ALR/Alpha
  722 + - - - - - - - 10q11.1 41847452-41858698 ALR/Alpha
AAGCTTTCCTTTAGGCCACAGAGTTGAAGCTT 1904 - + + - - - - - 10q11.1 41847960-41863582 ALR/Alpha
  345 - - + + - - + - 10q11.1 41720491-41722352 ALR/Alpha
AAGCTTTCTTTTTCATCAAGGAGTTTAAGCTT 386 + - - - - - - - 10q11.1 41720293-41720661 ALR/Alpha
AAGCTTTGAAATCTCCCACCTAAAGGAAGCTT 408 + - + + + + + - 10q11.1 41718623-41722413 ALR/Alpha
  750 - - + + - - - - 10q11.1 41847563-41863586 ALR/Alpha
  1262 + - - - - - - - 10q11.1 41718623-41720552 ALR/Alpha
AAGCTTTTCTTTTCATCAAGGAGTTTAAGCTT 1379 - - + - - - + - 10q11.1 41718797-41720661 ALR/Alpha
  691 - - + - - + - - 10q11.1 41718460-41720661 ALR/Alpha
  2041 + - - - - - - - 10q11.1 41847790-41866145 ALR/Alpha
  832 + - - - - - - - 10q11.1 41718460-41720661 ALR/Alpha
  347 - - - + - + + - 10q11.1 41718460-41720661 ALR/Alpha
  1024 + + - - - + + - 10q11.1 41718117-41720661 ALR/Alpha
AAGCTTTTGAGGCCAACACAGAGTTGAAGCTT 620 - + - - - + + + 10q11.1 41849321-41855026 ALR/Alpha
  281 + + - - - - - - 10q11.1 41849321-41850276 ALR/Alpha
AAGCTTCCTGTGATGATTCGAGAGAGAAGCTT 1419 + + - - + + - - 17p11.1 22175465-22179262 ALR/Alpha
  576 - - - - - + + + 17p11.1 22182601-22184019 ALR/Alpha
  1966 + - + - - - - - 17p11.1 22175465-22186396 ALR/Alpha
  2314 - - + - - + - - 17p11.1 22173089-22186396 ALR/Alpha
  234 + + + + - + - + 17p11.1 22170709-22172128 ALR/Alpha
  578 + + + - - + - + 17p11.1 22176307-22179262 ALR/Alpha
  1090 - + - - - - + + 17p11.1 22170709-22179262 ALR/Alpha
AAGCTTTCTCTCTCGACATCACAGAGAAGCTT 641 + - - - - - - - 17p11.1 22178721-22179262 ALR/Alpha
  1389 + - - - - - - - 17p11.1 22175464-22184019 ALR/Alpha
  1824 + - - - - - - - 17p11.1 22175464-22181640 ALR/Alpha
  579 - + - - + + + - 17p11.1 22170709-22179262 ALR/Alpha
  1420 - + + - + + - - 17p11.1 22180222-22184019 ALR/Alpha
AAGCTTCTCTCTCGAACATCGCAGAGAAGCTT 1091 + - - - - + - + 17p11.1 22173083-22184019 ALR/Alpha
  749 - - + - - - - + 17p11.1 22183291-22184019 ALR/Alpha
AAGCTTCTCTGAGATGTTCGAGAGAGAAGCTT 579 + + + + - - + + 17p11.1 22181236-22184019 ALR/Alpha
  918 + + + - - - - - 17p11.1 22173087-22184019 ALR/Alpha
  407 - + - + - + - - 17p11.1 22174101-22184019 ALR/Alpha
  406 - - + - - - - + 17p11.1 22175464-22176883 ALR/Alpha
  1087 + - - - - - - - 17p11.1 22175459-22181640 ALR/Alpha
AAGCTTCTGAGAATGCTTTTCTGAAAAAGCTT 355 + + - - + + + - 17p11.1 22184624-22184977 ALR/Alpha
  1037 + - - - - - - - 17p11.1 22184624-22186848 ALR/Alpha
AAGCTTTGAGACCTGTCTCAGAGTTGAAGCTT 799 + + + - + + + - 17p11.1 21687309-21687527 ALR/Alpha