Skip to main content

Table 1 Primer sequences used in the current study.

From: Expression stability of putative reference genes in equine endometrial, testicular, and conceptus tissues

Gene GenBank accession # Forward primer (5' to 3') Reverse primer (3' to 5') product size
GUSB XM_001493514 GGGATTCGCACTGTGGCTGTCA CCAGTCAAAGCCCTTCCCTCGGA 116
Cyp19a1 NM_001081805 GAGATGCCGTGGGAATTCTA CCACGTTTCTCAGCCAAAAT 111
ACTB NM_001081838 CGACATCCGTAAGGACCTGT CAGGGCTGTGATCTCCTTCT 99
B2M NM_001082502 GTGTTCCGAAGGTTCAGGTT ATTTCAATCTCAGGCGGATG 102
SLC36A2 XM_001501324 GCTTCTGCCACAGGCTTAAC CCGGCTTTGAGTCCATACAT 69
GAPDH NM_001163856 AGAAGGAGAAAGGCCCTCAG GGAAACTGTGGAGGTCAGGA 87
SDHA XM_001490889 GCAGAAGAAGCCATTTGAGG CCTGTCGATTACGGGTCTGT 103
YHWAZ XM_001492988 TGTTGTAGGAGCCCGTAGGT ATTCTCGAGCCATCTGCTGT 95
18S XM_001497064 AACGACACTCTGGCATGCTAACTA CGCCACTTGTCCCTCTAAGAA 98