Skip to main content

Table 1 Sequences of siRNAs, RNA oligos and RT-qPCR primers used in the study

From: The importance of RT-qPCR primer design for the detection of siRNA-mediated mRNA silencing

siRNAs
Name Passenger strand Guide strand
RRM1-2 CCCAGUUACUGAAUAAGCAGAUCUU AAGAUCUGCUUAUUCAGUAACUGGGCU
RRM1-3§ GCAAACUCACUAGUAUGCACUUCUA UAGAAGUGCAUACUAGUGAGUUUGCCU
ApoB-1§ GUCAUCACACUGAAUACCAAU AUUGGUAUUCAGUGUGAUGAmC*mA*C
ApoB1 mm control GUGAUCAGACUCAAUACGAAU AUUCGUAUUGAGUCUGAUCAmC*mA*C
81-control AAGAUCUGCUUAUUCAGUAACUGGG CCCAGUUACUGAAUAAGCAGAUCUU
Single-strand RNA oligos
Name Sequence
RRM1-3-sense GCAAACUCACUAGUAUGCACUUCUA
RRM1-3-antisense UAGAAGUGCAUACUAGUGAGUUUGCCU
qPCR Primers
Target Forward Reverse
RRM1(A) TGGATCAAGGTGGGAACAAG CGACGAGAAGGAAAGGACAC
RRM1(B) GGTACAAGGTCTGGCAGATGCT TTCCAGTGTCGACCGAAGGT
RRM1(C) CATCCACATTGCTGAGCCTAAC GGGTCAGAAGTTTGGGACGAA
ApoB1 site AGCCATGGGCAACTTTACCT AAAGGAAATGGGCAACGATA
ApoB external GGCACTGTGGGTCTGGAT TTCTTCTCTGGAGGGGACTG
HMBS AGCCTGTTTACCAAGGAGCT GAGTGAACAACCAGGTCCAC
LMNA TGAGGCCAAGAAGCAACTTCA CTCATGACGGCGCTTGGT
Polr2a TTACTCCCCTGCATGGTCTC TGGGAGACATAGCACCACCT
  1. * Represents phosphorothioate linkages between nucleotides in the siRNA backbone. Targets RRM1-A, B and C represent the cleavage sites for the various RRM1-specific siRNAs, as shown schematically in Figure 1A. §RRM1-3 and ApoB1 are complementary in sequence to both human and mouse target genes. Accession numbers: RRM1, NM_001033.3; LMNA, NM_005572.3; HMBS, NM_000190.3; ApoB, NM_009693.2; Polr2a, NM_009089.2. Amplicon sizes: RRM1(A): 114 bp; RRM1(B): 127 bp; RRM1(C): 79 bp; LMNA: 139 bp; HMBS: 65 bp; ApoB1 site 107 bp; ApoB external: 86 bp; Polr2a: 95 bp
\