Skip to main content

Advertisement

Table 1 Primers, probes, siRNAs used

From: Increased expression of Ero1L-alpha in healing fetal wounds

Primer Number/Name
(from Figure 2A, if applicable)
Direction Primer Sequence
1 F TCAGCCAGTGTGGAAGGAGGGA
2 F AGGAGACGCAGAAGGCTGTTC
3 F TTGGGTTGTTTTGGTGGTAGAAAGGT
4 F GCCGACAGTCAGCAAGTTTGCTTTATC
5 F GCAGGGCTTGTGGATGTAATGTG
6 R CTGATGTCATTCCAGAAAGGAC
7 R TAACAGCACAGTCCCTCCTTCCACAC
8 R TCAGAGCAGTACCCAAACCCTG
9 R CGGAACAGCAATGGAGTTGGTAAG
clone11 siRNA sense   rGrUrGrCrUrArCrArCrArGrArCrCrUrGrUrCrUTT
clone11 siRNA antisense   rArGrArCrArGrGrUrCrUrGrUrGrUrArGrCrArCTT
scrambled siRNA sense   rUrGrCrGrArUrArCrGrArCrArUrCrCrUrCrGrUTT
scrambled siRNA antisense   rArGrUrArCrCrUrGrCrUrGrGrGrUrCrArGrArATT
Ero1LA real time for F ACCTGAAGAGGCCTTGTCCTTT
Ero1LA real time rev R TCCATCAGGAACTTCATCAGATTG
Ero1LA real time probe P TGGAATGACATCAGCCAGTGTGGAAG
clone11 real time for F CTCTGAAAACATGACTCCCTCCTT
clone11 real time rev R AGGAGTCTGGCTTTCTCCTGAA
clone11 real time probe P CACCGCTCTGTGACCTCCTGAAC
GAPDH real time for F CTCTGAAAACATGACTCCCTCCTT
GAPDH real time rev R CCTCGGTGTAGCCCAGGAT
GAPDH real time probe P AAGCAGGCATCCGAGGGCCC