Skip to main content

Advertisement

Table 2 PCR primers used in this study

From: Utility of arsenic-treated bird skins for DNA extraction

Primer Sequence (5'-3') Source
CR-Cor14+ GGAGTTATCTTCCTCTTGAC Designed for this study
Phe-Cor- TTGACATCTTCAGTGTCATGC [31]
CR-Cor13- GGTGGTTTGGATAATGTAGGT Designed for this study
CR-Cor12- GAAACATGTCCGGCAACCAT Designed for this study