Skip to main content

Table 2 Primer probe sets.

From: TFRC and ACTB as the best reference genes to quantify Urokinase Plasminogen Activator in breast cancer

Target Accession No. Sequence Melting TM efficiency
GAPDH NM_001002 F GAAGGTGAAGGTCGGAGTC 61.3 94
   R GGGTGGAATCATATTGGAACA 63.2  
   P ATTTGGTCGTATTGGGCGCCTGGT 74.9  
TFRC NM_003234 F ACCGGCACCATCAAGCT 64.5 94
   R TGATCACGCCAGACTTTGC 65.2  
   P TGAAAATTCATATGTCCCTCGTGAGGCT 72.1  
RPLP0 NM_001002 F CGGACGAGGATATGGGATTTG 67.2 89
   R AGAAGTAAGCCTTTATTTCCTTGTTT 64.7  
   P TCACCAAAAAGCAACCAACTTAGCCAGT 72  
GUSB NM_000181 F GCGTTCCTTTTGCGAGGAGA 68.6 74
   R GGTGGTATCAGTCTTGCTCAA 64.7  
   P ACCAGGTATCCCCACTCAGTAGCCAAG 72  
HPRT1 NM_000194 F TGGACTAATTATGGACAGGACTGAA 64.4 103
   R GTAATCCAGCAGGTCAGCAA 62.8  
   P CTTGCTCGAGATGTGATGAAGGAGATGG 73.7  
UPA NM_002658 F AGGGCAGCACTGTGAAATAGATAAGT 65.7 97
   R CATGGTACGTTTGCTGAAGGA 64.8  
   P TTACCGAGGAAAGGCCAGCACTGACA 75.3  
ACTB NM_001101 F CAGCAGATGTGGATCAGCAAG 65.9 95
   R GCATTTGCGGTGGACGAT 67.1  
   P AGGAGTATGACGAGTCCGGCCCC 73.8  
  1. Probes were labeled with 5' FAM and 3' TAMRA.