Skip to main content

Table 1 Primers designed for scFv cloning and annealing temperatures.

From: Cloning approach and functional analysis of anti-intimin single-chain variable fragment (scFv)

Primers Sequence Annealing T°
VH Forward 5' GGATCC GTGCAGCTGCAGGAGTCTGG 3' 60°C
VH Reverse Linker 5' ACCGCCTCCACCGGAGACGGTGACCGTG 3' 76°C
VL Forward Linker 5' GGTGGCGGATCGGACATTGTGCTGACC 3' 78°C
VL Reverse 5' AAGCTT TTA GTTTGATTTCCAGCTTGGTGCC 3' 70°C
  1. Heavy chain forward primer contains the restriction site BamHI (bold). At the light chain reverse primer was inserted the restriction site HindIII (italic) and a stop codon (bold/italic)