Skip to main content

Table 1 Boechera-specific qRT-PCT primers for tested HKGs

From: Selection of reference genes for quantitative real-time PCR expression studies of microdissected reproductive tissues in apomictic and sexual Boechera

Gene identification/Gene description Primer sequence 5'-3' forward/reverse Amplicon size (bp) Amplification efficiency ± SD * EMBL Accession Number
BoechACT2/Actin 2 GTTCCACCACTGAGCACAATGTTACC/AGTCTTGTTCCAGCCCTCTTTTGTG 132 0.94 ± 0.003 FR846456
BoechEF1/Elongation factor-1 alpha CCAAGGGTGAAAGCAAGGAGAGC/CACTGGTGGTTTTGAGGCTGGTATCT 75 0.96 ± 0.002 FR846458
BoechRPS18/Ribosomal protein S18 GCTGGGGAGTTATCTGCTGCTGAG/CTTGCCGTCTTTGTAATCCTTCTGC 117 0.94 ± 0.003 FR846460
BoechPEX4/Peroxin 4 TTTGCAGTTGACAGTTGGATCTTGTTC/TCGCTCGTGATGCCTATTCATCATAC 143 0.83 ± 0.009 FR846459
BoechAt1g09770.1/Arabidopsis thaliana cell division cycle 5 GCCATGATCTAAAAAGTTGGGACAAA/TATTCGTCACAACACATGCAAGGTTTA 145 0.88 ± 0.007 FR846457
BoechUBQ/Polyubiquitine GGCTAAGATCCAGGACAAGGAAGGTAT/CTGGATGTTATAGTCAGCCAAAGTGCG 71 0.94 ± 0.004 FR851958
  1. *Amplification efficiency was calculated using the miner algorithm [30] for both the means and corresponding SD: x ̄ = σ 2 i = 1 n 1 σ i 2 x i [39]