Skip to main content

Table 1 Gene specific-primers and key PCR conditions.

From: Identification of Phosphoglycerate Kinase 1 (PGK1) as a reference gene for quantitative gene expression measurements in human blood RNA

Gene Symbol(GenBank #)
Name
Primer (5'-3')* Anneal-ing
Temp (°C)
Ampli-con
Size
(bp)
PCR Efficiency
YWHAZ (NM_003406)
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
FW: TGATCCCCAATGCTTC
RV: TGTTGTGACTGATCGAC
60 127 1.81
PPIB (NM_000942)
Peptidylprolyl isomerase B
FW: CAGCAAATTCCATCGTG
RV: CCGTAGTGCTTCAGTTT
60 132 1.97
RPLP0 (NM_015741)
Ribosomal protein, large, P0
FW: CCTTCTCCTTTGGGC
RV: CCGTAGTGCTTCAGTTT
60 133 1.83
PGK1 (NM_000291)
Phosphoglycerate kinase 1
FW: CAAGAAGTATGCTGAGGCTGTCA
RV: CAAATACCCCCACAGGACCAT
58 68 1.93
POLR2A (NM_000937) Polymerase (RNA) II (DNA directed) polypeptide A, 220 kDa FW: ATCTCTCCTGCCATGACACC
RV: AGACCAGGCAGGGGAGTAAC
62 162 1.94
EAR
Expressed Alu Repeats
FW: GAGGCTGAGGCAGGAGAATCG
RV: GTCGCCCAGGCTGGAGTG
62 87 1.91
CAB (X56062) Arabidopsis thaliana chlorophyll A-B binding protein FW: CTCAGGAATGGGCAGCACTACC
RV: CAGAATCCTACAAACGCCAACAGC
60 273 1.96
  1. *FW, forward primer; RV, reverse primer