Skip to main content

Table 2 Primer sequences, exon locations, amplicon size, and optimal melting temperature of canine candidate reference genes.

From: Leukocyte count affects expression of reference genes in canine whole blood samples

Gene Forward 5' →3'* Exon(s) Reverse 5' → 3' Exon(s) Product length (bp) Tm(°C)
RPS19 CCTTCCTCAAAAA/GTCTGGG 2/3 GTTCTCATCGTAGGGAGCAAG 3 95 61.0
RPL8 CCATGAAT/CCTGTGGAGC 4/5 GTAGAGGGTTTGCCGATG 5 64 55.0
RPS5 TCACTGGTGAG/AACCCCCT 2/3 CCTGATTCACACGGCGTAG 3 141 62.5
GUSB AGACGCTTCCAA/GTACCCC 3/4 AGGTGTGGTGTAGAGGAGCAC 4 103 62.0
B2M TCCTCATCCTCCTCGCT 1 TTCTCTGCTGGGTGTCG 2 85 61.2
HNRNPH CTCACTATGATCCACCACG 5 TAGCCTCCATAAC/CTCCAC 5/6 151 61.2
HPRT AG/CTTGCTGGTGAAAAGGAC 5/6 TTATAGTCAAGGGCATATCC 7 114 56.0
GAPDH TGTCCCCACCCCCAATGTATC 2 CTCCGATGCCTGCTTCACTACCTT 2 100 58.0
SRPR GCTTCAGGATCTGGACTGC 5/6 GTTCCCTTGGTAGCACTGG 6 81 61.2
  1. * If a primer is located on two exons, the junctions are shown with a dividing forward slash (/).
  2. Genomic product size would be approximately 3.6 kb.
  3. Genomic product size would be approximately 300 bp.