Skip to main content

Table 1 Primers used for identification of glucose-6-phosphate dehydrogenase defectsa

From: Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in Jeddah, Kingdom of Saudi Arabia

Analysis Analyzed Region Forward 5'→3' Reverse 5'→3'
RFLP Analysis (Tm = 61°C) Exon 3 GTGGAGGATGATGTATGTAGGT AGGGCAGGGCACAGCTGTAA
  Exon 4 TACAGTCGTGCCCTGCCCT CCGAAGCTGGCCATGCTGG
  Exon 5 CTGTGTGTGTGTCTGTCTGTC GGAGGGCAACGGCAAGCCTT
  Exon 6 GCAGCTGTGATCCTCACTCC GCAAGGTGGAGGAACTGACC
Gene sequencing (Tm = 56°C) Exons
1, 2
AAGCTCGGTAATGATAAGCACGC TGGAGCAGGCACTTCCTGG
  Exons
3, 4, 5
GTGGAGGATGATGTATGTAGGT GGAGGGCAACGGCAAGCCTT
  Exons
6, 7, 8
AGAGGGTCATCTGGGAACACAA CCTGGGACATGACAACTTGGG
  Exons
9, 10, 11, 12, 13
TCTGTGGCCACAGTCATCCC CGCCCTCCTCCTTCCTTCTG
  1. Abbreviations: A, alanine; C, cysteine; G, glycine; RFLP, restriction fragment length polymorphism; Tm, Anealing temperature; T, threonine
  2. aAdapted from Moradkhani et al.[14]