Skip to main content

Table 2 Primers used to detect skip and wildtype transcripts.

From: Cyclic stretch increases splicing noise rate in cultured human fibroblasts

Name Exon Sequence 5'-3' P AT
AATF S3 H 2-4 CCAGGATCGTCTGCACTG 96 59.5
AATF S3 R 4 AACATCTGGTTGAGGAAGCTG 96 59.5
AATF WT H 2 GACACGGACAAAAGGTATTGC 122 59.5
AATF WT R 3 TCTCCAGACCCTTCCTCATC 122 59.5
MAP3K11 S9 H1 8-10 CCAGCACTCAATGGAGGC 149 59.5
MAP3K11 S9 R 10 AAGCTCCAGGGATCAATGC 149 59.5
MAP3K11 WT H 7 GGAGGACTCAAGCAATGGAG 120 59.5
MAP3K11 WT R 8 AGGTACCATGTGGCTTCGTC 120 59.5
NF1 S38 H 37-39 AGACACCAAAGTTTCTATTAAAGTCAGCT 62 60
NF1 S38 R 39 GGTACAAGTTAAGGCACACAGAAGATTA 62 60
NF1 S39 H 38-40 TCTGACCCGAGTTTACGGTATTG 72 60
NF1 S39 R 40 AGATTTGACAGCCATGGAGTCAT 72 60
NF1 WT H 38 GCAGTTCTGACCCGAGTTTACG 99 60
NF1 WT R 39 ATGTCTCTAGTAACTGGCCCTCGAT 99 60
PCGF2 S10 H1 9-11 CCCAGCAAGTACAAGAACGG 139 60
PCGF2 S10 R1 11 CGCTGACTGACTCACACTCG 139 60
PCGF2 WT H 9 AAGTTTCTCCGCAACAAGATG 100 60
PCGF2 WT R 10 CGATGTCCATGAGGGTGTAG 100 60
POLR2A S23 H 22-24 GAGAACAAGATGCAAGAGGTGTAC 88 59.5
POLR2A S23 R 24 CCTTGAATTCCCCATCCTC 88 59.5
POLR2A WT H 22 GTTTTGGTGACGACTTGAACTG 145 59.5
POLR2A WT R 23 CGCAGGAAGACATCATCATC 145 59.5
RABAC1 S4 H 3 CGTCCCCTATGTTGCTGGTG 107 63
RABAC1 S4 R2 3-5 CACCAGGGTGGCTCCAAAG 107 63
RABAC1 WT H1 2 GCAACTATGTGTTCGTGTTCCTG 148 61
RABAC1 WT R1 3-4 TCTCGGCCAAAGAGCACA 148 61
  1. Primers for detection of erroneously spliced (S) and wildtype (WT) AATF, MAP3K11, NF1, PCGF2, POLR2A and RABAC1 transcripts respectively, their position related to the exons (Exon), sequence, length of the amplified product (P in bp) and annealing temperature (AT in °C). The applied concentrations in qPCR were 200 nM.