Skip to main content

Table 1 List of computer predicted and verified miroRNA in  C. sinensis 

From: Validation and characterization of Citrus sinensis microRNAs and their target genes

miroRNA Predicted miRNA sequence Verified miRNA sequence
csi-miR160a UGCCUGGCUCCCUGUAUGCCA UGCCUGGCUCCCUGUAUGCCA
csi-miR162 UCGAUAAACCUCUGCAUCCAG UCGAUAAACCUCUGCAUCCAG
csi-miR165a UCGGACCAGGCUUCAUCCCCC UCGGACCAGGCUUCAUCCCCC
csi-miR166a UCGGACCAGGCUUCAUUCCCCC UCGGACCAGGCUUCAUUCCCCC
csi-miR166b UCGGACCAGGCUUCAUUCCCG UCGGACCAGGCUUCAUUCCCG
csi-miR172a AGAAUCUUGAUGAUGCUGCAA AGAAUCUUGAUGAUGCUGCAA
csi-miR390 AAGCUCAGGAGGGAUAGCGCC AAGCUCAGGAGGGAUAGCGCC
csi-miR482a.1 UCUUCCCUACUCCACCCAUG  
csi-miR482a.2 UCUUCCCUACUCCACCCAUGCC UCUUCCCUACUCCACCCAUGCC
csi-miR482a.3 UCUUCCCUACUCCCCCCAUG  
csi-miR482a.4 UCUUCCCUACUCCCCCCAUGCC UCUUCCCUACUCCCCCCAUGCC
csi-miR530 UGCAUUUGCAGGUGCAUCAU UGCAUUUGCAGGUGCAUCAU
csi-miR844 CUAUAAGCCAUCUCACUAGGU CUAUAAGCCAUCUCACUAGGU
csi-miR950 UCAGGUCCUCAGUGGUCCAU UCAGGUCCUCAGUGGUCCAU
csi-miR1027 UUUCUAUCAUCUAUUCCAAUG UUUCUAUCAUCUAUUCCAAUG
csi-miR1044-3p UUGUAGUGCGUAUUGGUAUU UUGUAGUGCGUAUUGGUAUU
csi-miR1426 UGAAUCUUGAUGAUGAUUGAU UGAAUCUUGAUGAUGAUUGAU