Skip to main content

Table 2 Primers used for qPCR

From: Nature of bacterial colonization influences transcription of mucin genes in mice during the first week of life

Primer name Fwd (5´-3´) Rev (5´-3´) Amplicon size Reference
Muc1 TCGTCTATTTCCTTGCCCTG ATTACCTGCCGAAACCTCCT 185 This study
Muc2 CCCAGAAGGGACTGTGTATG TTGTGTTCGCTCTTGGTCAG 276 Modified from [44]
Muc3 TGGTCAACTGCGAGAATGGA TACGCTCTCCACCAGTTCCT 98 Modified from [6]
Muc4 GTCTCCCATCACGGTTCAGT TGTCATTCCACACTCCCAGA 280 This study
Tff3 CTCTGTCACATCGGAGCAGTGT TGAAGCACCAGGGCACATT 77 [45]
Neuroplastin CGCTGCTCAGAACGAACCAAGAA CTTACGGGTGGCAGTGAGTT 160 Modified from [46]
Beta-actin GTCCACCTTCCAGCAGATGT GAAAGGGTGTAAAACGCAGC 117 This study
Lactobacillus 16S rRNA AGCAGTAGGGAATCTTCCAa CACCGCTACACATGGAGb 341 a[47]
b[48]
E. coli 16S rRNA CATGCCGCGTGTATGAAGAA CGGGTAACGTCAATGAGCAAA 96 [49]