Skip to main content

Table 1 Primers used in this study

From: A single copy integration vector that integrates at an engineered site on the Staphylococcus aureus chromosome

Primer Sequence
L54aInt1 ggatccacatttagtagctagtactaaaatc
L54aAttP1 ggtttaccatcatgccaggatgggattaacttgtgttaaaaag
L54aAttP2 gttaatcccatcctggcatgatggtaaaccggtcattctct
L54aAttP3 agatctatcgatacggttatatttattcccctac
L54aAttP4 agatctactaaaaggtatctgccctttttctg
L54aAttP5 atcgataatttaggattgtggttattttttgcg
L54aAttP6 ggtttaccatcgtgtcacgatgggattaacttgtgttaaaaag
L54aAttP7 gttaatcccatcgtgacacgatggtaaaccggtcattctct
OU937R3 gaaccaattgaacaagcttgtgaag
OU937R8 ttacttactatttatgaatggccag
OU937R9 gaattcggacaagtttgtacaaaaaagcaggctgtcgctgaagttgcatcaacttgt
OU937attBf ccaaatttataatttgccaatcatgcc
OU937attBr gttcgaaaattataatcccatcctggc
OU937R10 gaaaattataatcccatcctggcatgattggcaaattataaatttggtacataatagac
OU937R11 ataatttgccaatcatgccaggatgggattataattttcgaactggttaaattcg
OU937R12 ggatccggaccactttgtacaagaaagctgggtatccatttagctccgattgcttc
OU9R1 ggggacaagtttgtacaaaaaagcaggctcagcaggtagagatacaagagga
OU9R2 tgcattggatcccatcgtgacacgattggctcactattatatttttacagcac
OU9R3 taatagtgagccaatcgtgtcacgatgggatccaatgcacataacaacaataaattaag
OU9R4 ggggaccactttgtacaagaaagctgggtactaaagttttgagacgaagccac
OU9R5 gtaaaaatataatagtgagccaatcgtgtc
OU9R6 tgtgcattggatcccatcgtgac
OU9R7 atgggtggtaaaacacaaatttc
OU9R8 ctcactattatatttttacagcac
OU9R9 ccaatgcacataacaacaataaattaag
OU9R10 catactacatatcaacgaaatcag
SCV1 gcaacaccacataatggttcac
SCV2.1 tgtgccatgataacagcacg
SCV4 acccagtttgtaattccaggag
SCV8 gcacataattgctcacagcca
SAO9F3 aaggtgcgcaattagagcgtgct
SAO9R3 tctgcgttcacaagctgtggtacc
SAO10F3 atgccggtgctgcgcaattt
SAO10R3 ggcgacgccaaa cgtttcgt