Skip to main content

Table 3 Sequencing and qPCR primers for ceramide metabolism genes

From: Characterization of genes involved in ceramide metabolism in the Pacific oyster (Crassostrea gigas)

Gene description Elongation factor 1 α (EF1α) Serine palmitoyltransferase (Sptlc1) 3-ketodihydrosphingosine reductase (3KDSR) Acid ceramidase (AC) Glucosylceramide synthase (GlcCer)
Sequencing Forward Primer - ATGGCGTCGACGTTCA TTCC AGCGACGGACCGAACTTACT TGTGATTACACGAT GTGGATACCG AGAGGCGAACACA CGAAAGT
Sequencing Reverse Primer - CTGTTCCCCAATATTTC TGAC TGTCTTGGGTTTTGCATCCTTC CTGCTTCTGACTTC CGGTGT CCATATGGATAACAC TTCTCG
Sequence Product Size (bp) - 1483 1210 1165 1080
qPCR Forward Primer AAGGAAGCTGCTGA GATGGG TTCACAGCAAGCT GAGCGAT GCAGTGCAGTGGCTGGAAAT TGGACTCAAGTTGG CCAGGA TTGGCCCAAACGGG AAAGTT
qPCR Reverse Primer CAGCACAGTCAG CCTGTGAAGT AAGTAGCGAGCC AACGTCAC AGGCAGCCTTGGTGACATTG AAGGCTGGGGGAG AGTATCG TGTCCATGAGCGAGT CTGGT
qPCR Product Size (bp) 200 178 168 157 114