Skip to main content

Advertisement

Table 1 Primer sequences and amplicon information for the quadruplex HRM PCR assay

From: Rapid multiplex high resolution melting method to analyze inflammatory related SNPs in preterm birth

SNP reference number Gene Chromosome Primer sequence (5'-> 3') PCR product size (bp) Primer concentration in multiplex PCR (μM)
rs4986790 TLR4 9 F ATTTGACCATTGAAGAATTCCG 157 2.46
    R TGTTGCCATCCGAAATTATAAG   
rs1800795 IL6 7 F GCCTCAATGACGACCTAAGC 105 0.46
    R GGGGCTGATTGGAAACCTTA   
rs16944 IL1β 2 F CTTGGGTGCTGTTCTCTGCCTC 126 0.26
    R CAACTCCGTCAGGAGCCTGAAC   
rs375947 IL12RB 19 F CTGCCATTCAATGCAATACG 241 0.9
    R CCCTGTAGGGTCAGGGGTAT