Skip to main content

Table 1 Primers, amplicon size, enzymes, expected fragments size after digestion and references used for genotyping

From: Distribution of CCR5-Delta32, CCR5 promoter 59029 A/G, CCR2-64I and SDF1-3A genetic polymorphisms in HIV-1 infected and uninfected patients in the West Region of Cameroon

Genes Primers sequence (5’-3’) Size of the amplicon (bp) Enzyme used for the RFLP Expected fragments size (bp) Reference
CCR5-Δ32 CTTCATCATCCTCCTGACAATCG 262 (wt) None 262 or 230 [33]Kristiansen et al., 2001
GACCAGCCCCAAGTTGACTATC 230 (mut)   
CCR5 promoter A/G TGGGGTGGGATAGGGGATAC 498 Bsp 1286I 453 + 45 [33]Kristiansen et al., 2001
TGTATTGAAGGCGAAAAGAATCAG    
CCR2-64I GGATTGAACAAGGACGCATTTCCCC 380 Fok I 215 +165 [34]Magierowska et al., 1999
TTGCACATTGCATTCCCAAAGACCC    
SDF1-3A CAGTCAACCTGGGCAAAGCC 302 Msp I 202+ 100 [33]Kristiansen et al., 2001
  AGCTTTGGTCCTGAGAGTCC