Skip to main content

Advertisement

Table 7 Details of primers used for the cDNA amplification of six candidate reference genes

From: Selection and validation of reference genes for quantitative gene expression studies by real-time PCR in eggplant (Solanum melongena L)

Name Accession number Forward primer 5′-3′ Reverse primer 5′-3′ Length (bp) Tm(°C)
18S rRNA X67238 CGCGCAAATTACCCAATCCTGACA TCCCGAAGGCCAACGTAAATAGGA 416 60
APRT CK270447 TGGCGCCTCATGATCCGATTCTTA ACTCCAACACGCTCAAGAAGCCTA 454 60
GAPDH U17005 AACCGGTGTCTTCACTGACAAGGA GCTTGACCTGCTGTCACCAACAAA 586 60
Cyclophilin AF126551 AGGGTTCATGTGTCAAGGAGGTGA TCCAACAGCCTCGGCCTTCTTAAT 265 60
Actin X55749 TGTGTTGGACTCTGGTGATGGTGT AATAGGACCTCAGGGCAACGGAAT 333 60
RuBP FS083182 GCAGGTGTGGCCACCAATTAACAA TGCACTCTCCGACCTCATTCAACA 269 60