Skip to main content

Table 1 Candidate reference genes and target genes primer sequences, amplicon length and qPCR analysis

From: Validation of reference genes for normalization of qPCR gene expression data from Coffea spp. hypocotyls inoculated with Colletotrichum kahawae

Gene (coffee Reference Primer sequence Amplicon length (bp) Ta (°C) Tm (°C) PCR efficiency (%) Regression coefficient (R2) Average Cq value
source gene)         
VATP16 (GT00156.1)* Gamm et al. [29] Fw: ATAGAGAGAGAGCCCCCAATTC 150 60 78.63 Discarded (unspecific amplification, primer dimer)
Rev: CCGAGGAAGCCAAAAAAAG
UQCC (isotig09120) Fw: CCTCGGGCTTCATCTCTACTC 156 60 77.21
Rev: TCTCCCCAGCATTTTTTGTC
SAND (isotig05620) Selim et al. [30] Fw: GATTTGTCTACGAACCCTGCTT 116 60 78.70
Rev: GGACCACCAACACCAATAAAC
UBQ9 (AF29708)* Ramiro et al. [7] Fw: AACATTGAGGGTGGTTCTGTTC 79 60 76.16 92 0.987 24.5 ± 0.95
Rev: GCAGAAAACCAACTAAGACCTAACAA
S24 (SNG-U349723)a Cruz et al. [28] Fw: GCCCAAATATCGGCTTATCA 92 60 76.60 91 0.996 20.61 ± 1.04
Rev: TCTTCTTGGCCCTGTTCTTC
IDE (isotig10635) Borges et al. [12] Fw: TGATCTAAGCTGGTGGAAAGC 91 55 76.28 92 0.994 24.46 ± 1.30
Rev: TCAGGTGCATCAGGATGATT
β- Tub9 (isotig08544) Fw: ACCCTCCAGCAAACTGATGA 100 55 77.27 96 0.996 19.40 ± 0.82
Rev: AGGATGCCACTGCTGATGAT
14-3-3 (SGN-U356404)a Barsalobres-Cavallari et al. [18] Fw: TGTGCTCTTTAGCTTCCAAACG 75 60 73.33 103 0.999 22.76 ± 1.47
Rev: CTTCACGAGACATATTGTCTTACTCAAA
GADPH (SGN-U347734)a Fw: TTGAAGGGCGGTGCAAA 59 60 75.73 96 0.998 21.42 ± 1.96
Rev: AACATGGGTGCATCCTTGCT
RPL7 (SGN-U351477)a Barsalobres-Cavallari et al. [18] Fw: CATTCGAGGTATCAATGCTATGCA 66 60 76.48 89 0.999 23.76 ± 1.28
Rev: TGTCTCAGGCGCAGAAGCT
Genes of interest (GOIs)
PR10 (CF589103)* Ramiro et al. [7] Fw: GCCACCATCCTTGAAGAGAA 151 55 80.17 99 0.999 19.35 ± 2.28
Rev: CAACTCTCTGCTTGGCAGTCT
RLK (CF589181)* Fw: ATGGGAGAAAAGAATGGCAGAAG 189 55 81.15 91 0.998 24.81 ± 2.02
Rev: GGCCAATTACAGTTTGAAAACACC
  1. aUnigene accession number according to the SOL Genomics Network.
  2. Ta, annealing temperature; Tm, melting temperature; SD, standard deviation. * NCBI accession number or TC TIGR number.