Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Figure 2 | BMC Research Notes

Figure 2

From: Online exercise for the design and simulation of PCR and PCR-RFLP experiments

Figure 2

Clustering of PCR amplicons. Sequences from all amplicons are compared and clustered. To allow a fast response to several simultaneous users (as for example to students in a computers room) the amplicons with identical sequences are grouped and identified with a letter. In this example, amplicons obtained with primers GGGCGTGATCCATTTTTATG and CTATTTGCGCGTTTTTGACA from all 57 sequenced E. coli genomes are grouped into 16 groups with identical sequences (A to P).

Back to article page