Figure 2
From: Online exercise for the design and simulation of PCR and PCR-RFLP experiments
Clustering of PCR amplicons. Sequences from all amplicons are compared and clustered. To allow a fast response to several simultaneous users (as for example to students in a computers room) the amplicons with identical sequences are grouped and identified with a letter. In this example, amplicons obtained with primers GGGCGTGATCCATTTTTATG and CTATTTGCGCGTTTTTGACA from all 57 sequenced E. coli genomes are grouped into 16 groups with identical sequences (A to P).