Skip to main content

Table 1 Eight candidate reference genes assessed for gene expression normalisation in Olea europaea and amplicon characteristics

From: Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

Gene name Accession number/cluster ID* Primer sequence (5' to 3') Amplicon length (bp) Annealing temperature** (°C) PCR efficiency value*** Standard error (SE) R2****
60S RBP L18-3 [Oleadatabase:Cluster ID-OLEEUCl011221] contig 2 F: GTAAGAGCAAGAAGACCAAG 101 55 1.984 0.014 0.978
R: GCTTCCAGTTCTCCTCAC
PP2A [Oleadatabase:Cluster ID-OLEEUCl010038] contig 1 F: AGATCGGTGAAATACTTCCACACG 189 56 2.038 0.020 0.969
R: TCGTGGATACTACTCAGTGGAGACTG
PTB [Oleadatabase:Cluster ID-OLEEUCl031691] contig 1 F: CTTCTCCGAAATAAACCAGAT 156 56 2.243 0.057 0.855
R: GGTGTCAGCTCCAGTTGTAA
TUBA [Oleadatabase:Cluster ID-OLEEUCl051890] contig 1 F: AGAACACCTCAGCAACAC 100 51 1.704 0.069 0.870
R: AACTACCAGCCACCAACT
TIP2 [Oleadatabase:Cluster ID-OLEEUCl011159] contig 2 F: ACTTGTTGTAAGCAATGG 104 51 2.093 0.081 0.935
R: TGATTCATTAAGCGTTGG
OUB2 [GenBank:AF429430.1] F: AATGAAGTCTGTGTGTCCTTTGG 150 51 1.513 0.054 0.890
R: AAGGGAAATCCCATCAACG
GAPDH [GenBank:EF506530.1] F: ACAGCTCCTGGTAAGGGTGA 210 56 2.111 0.018 0.971
R: GGCTTGCGTCAAGAAGTCTC
EF1-alpha [GenBank:XM_002527974.1] F: GAATGGTGATGCTGGTTTCG 191 56 1.908 0.005 0.996
R: CCCTTCTTGGCAGCAGACTTG
  1. *Cluster ID obtained from the Olea database[26].
  2. **Annealing temperature used in PCR experiments.
  3. ***Measure of the PCR amplification efficiency calculated from calibration curve derived from prepared standards.
  4. ****correlation coefficient (R2) for the calibration curve.