Skip to main content

Table 1 Primers (Eurogentec) used for detection of EGFRvIII by real-time PCR

From: Mutation analysis of genes in the EGFR pathway in Head and Neck cancer patients: implications for anti-EGFR treatment response

Oligo name Oligo type Mod5’ Sequence Mod3’
EGFRe1-F forward primer   GAGTCGGGCTCTGGAGGAA  
EGFRe8-R reverse primer   GGCCCTTCGCACTTCTTACA  
EGFRe1/8-TM TaqMan probe 6-FAM AAAGGTAATTATGTGGTGACAGATCACGGCTC BHQ-1
EGFRe9/10-F forward primer   TCCTGCCGGTGGCATTT  
EGFRe9-R reverse primer   TGTGGATCCAGAGGAGGAGTATG