Skip to main content

Table 1 Candidate reference genes, primers used to amplify in teak and their PCR parameters

From: Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.)

Gene symbol Gene name Primer sequences (5′-3′) forward/reverse* Tm (°C) Amplicon (bp)
rp60s Ribosomal protein 60S ATGGTGAAGTTCTTGAAGCC/TGGTTCTTTACCAAGCTC 55 399
Cac Clathrin adaptor complex AAGGATAACTTTGTCATTGT/TGGGAAATACATGAAGGCG 58 794
Act Actin GTTAGCAATTGGGATGATATGG/ATCCAGACACTGTACTTCCT 57 797
His3 Histone 3 ACN GGTGGAGTGAAGAAGCC/TCCTTGGGCATGATN GTN AC 61 275
Sand Sand family protein ATATATTCCAGATATGGAGATGA/TAY ATGAAATGCCAAAGTCCA 55 941
Β-Tub Β-Tubulin ACN CAR CAAATGTGGGATGC/TCCCCAGTGTACCAR TGCAA 60 335
Ubq Ubiquitin TR ACGGGN AAGACCATAAC/ACCTTCTTN TTCTTGTGCTT 56 271
Ef-1α Elongation factor 1- α CATCAACATTGTGGTCATTGG/CCAGAN CGCCTGTCAATCTTG 55 1095
  1. Degenerate bases are indicated in bold.
  2. *Degenerate nucleotides used in some primers: N = any base, Y = C or T, R = A or G.